Incidental Mutation 'R7206:Sfmbt1'
ID560652
Institutional Source Beutler Lab
Gene Symbol Sfmbt1
Ensembl Gene ENSMUSG00000006527
Gene NameScm-like with four mbt domains 1
Synonyms4930442N21Rik, 9330180L21Rik, Smr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.685) question?
Stock #R7206 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location30714849-30822721 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 30811373 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054230] [ENSMUST00000112184] [ENSMUST00000227201] [ENSMUST00000227303] [ENSMUST00000228006]
Predicted Effect probably null
Transcript: ENSMUST00000054230
SMART Domains Protein: ENSMUSP00000056744
Gene: ENSMUSG00000006527

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 6.7e-43 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112177
SMART Domains Protein: ENSMUSP00000107799
Gene: ENSMUSG00000006527

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 6.7e-43 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112184
SMART Domains Protein: ENSMUSP00000107802
Gene: ENSMUSG00000006527

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 499 614 3.1e-41 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131706
SMART Domains Protein: ENSMUSP00000117866
Gene: ENSMUSG00000006527

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 7.3e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132451
Predicted Effect probably null
Transcript: ENSMUST00000227201
Predicted Effect probably null
Transcript: ENSMUST00000227303
Predicted Effect probably null
Transcript: ENSMUST00000228006
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares high similarity with the Drosophila Scm (sex comb on midleg) gene. It encodes a protein which contains four malignant brain tumor repeat (mbt) domains and may be involved in antigen recognition. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 G A 3: 60,025,241 M392I probably benign Het
Acr T C 15: 89,574,171 S352P probably benign Het
Adam6a T C 12: 113,546,034 C676R probably damaging Het
Adgra3 T C 5: 50,006,896 D247G probably damaging Het
Agxt2 A T 15: 10,377,456 E147D probably damaging Het
Atp2a1 T C 7: 126,447,972 T805A probably benign Het
Atp8b4 T C 2: 126,458,292 S106G probably damaging Het
Ccdc170 T A 10: 4,514,120 M87K possibly damaging Het
Ccnl2 T G 4: 155,820,974 V287G possibly damaging Het
Ccr6 A T 17: 8,256,949 M329L probably benign Het
Cflar G T 1: 58,740,991 M248I Het
Cib4 A T 5: 30,545,766 L5* probably null Het
Col27a1 A T 4: 63,235,346 Y645F probably benign Het
Cxcr2 A G 1: 74,159,054 T236A possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah7a A T 1: 53,698,633 L47* probably null Het
Dnajb6 A C 5: 29,781,337 K301T possibly damaging Het
Dpf2 T A 19: 5,904,543 I157F possibly damaging Het
Drd4 G A 7: 141,292,119 G28R probably damaging Het
Dupd1 A G 14: 21,677,034 V182A probably damaging Het
Dus3l A T 17: 56,767,807 I310F probably damaging Het
Eef1akmt3 A G 10: 127,040,993 L95P probably damaging Het
Fabp7 C T 10: 57,784,991 probably benign Het
Fam135a T C 1: 24,030,273 N505S probably benign Het
Fam213a T A 14: 41,004,185 M12L probably benign Het
Fam216b C A 14: 78,085,127 D46Y probably damaging Het
Gata6 C T 18: 11,054,850 R260C probably damaging Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm13124 T A 4: 144,558,641 D142V probably damaging Het
Golgb1 A G 16: 36,913,749 I1160M probably benign Het
Hfe2 A T 3: 96,528,128 D234V probably damaging Het
Kiss1 A G 1: 133,327,325 K26E probably benign Het
Knl1 T A 2: 119,069,299 F494I probably benign Het
Ktn1 T C 14: 47,695,528 L713S probably damaging Het
Loxhd1 A G 18: 77,441,817 D2052G probably damaging Het
Lpo A C 11: 87,807,423 L582R probably damaging Het
Map2k3 A G 11: 60,943,580 T125A Het
Matn3 T A 12: 8,961,170 N360K probably benign Het
Mlip A T 9: 77,164,862 V237E probably damaging Het
Mms22l T C 4: 24,591,146 V999A probably benign Het
Mn1 A G 5: 111,420,512 K783E possibly damaging Het
Myo1h A T 5: 114,319,775 K132* probably null Het
Nle1 A G 11: 82,904,931 V230A probably benign Het
Olfr1240 T C 2: 89,440,457 probably benign Het
Olfr1318 T G 2: 112,156,459 C169W probably damaging Het
Olfr22-ps1 A T 11: 73,954,821 I44F probably benign Het
Olfr356 T A 2: 36,937,772 Y218N probably damaging Het
Olfr564 T C 7: 102,803,684 S69P probably damaging Het
Olfr860 C T 9: 19,846,560 D20N probably damaging Het
Ormdl2 T A 10: 128,820,415 H7L possibly damaging Het
Pam A G 1: 97,896,032 S225P probably damaging Het
Pan2 C A 10: 128,314,545 Y719* probably null Het
Ppfia4 T C 1: 134,327,389 S243G probably benign Het
Ppig T G 2: 69,741,566 S210A unknown Het
Ppwd1 A T 13: 104,213,598 N426K probably damaging Het
Rnf10 T G 5: 115,244,121 D675A probably benign Het
Rrp12 A T 19: 41,878,039 L619H probably damaging Het
Rsph10b C T 5: 143,961,192 T497I possibly damaging Het
Scnm1 A T 3: 95,133,894 M1K probably null Het
Scp2 G T 4: 108,074,441 D332E probably benign Het
Senp3 T C 11: 69,678,731 I314V probably benign Het
Slc44a2 T C 9: 21,346,807 F451S probably damaging Het
Slfn1 A T 11: 83,122,011 M318L probably benign Het
Syne2 C T 12: 76,004,757 S4087L probably benign Het
Syt7 A G 19: 10,417,973 Y49C probably damaging Het
Tas2r134 T C 2: 51,628,108 Y200H probably benign Het
Tgfbr1 A T 4: 47,402,941 H315L probably damaging Het
Tmem184c A G 8: 77,596,577 V552A possibly damaging Het
Tnxb A G 17: 34,704,101 R2553G possibly damaging Het
Tomm40 C G 7: 19,710,936 R173S probably benign Het
Tonsl T C 15: 76,633,651 D650G probably damaging Het
Tpo G C 12: 30,103,134 S407W possibly damaging Het
Trank1 T C 9: 111,345,515 probably null Het
Trp53tg5 T C 2: 164,471,458 E99G probably damaging Het
Tubb2a C A 13: 34,075,522 S95I possibly damaging Het
Vav2 C A 2: 27,336,719 R114L probably benign Het
Vmn1r172 A T 7: 23,660,157 I156L possibly damaging Het
Vmn1r238 A G 18: 3,122,623 Y264H possibly damaging Het
Vmn2r26 T A 6: 124,039,768 M397K probably benign Het
Vmn2r73 T C 7: 85,872,867 N88S probably benign Het
Vps13a T C 19: 16,754,298 N150S probably damaging Het
Vps35 A T 8: 85,287,721 Y100N probably damaging Het
Vps8 A C 16: 21,457,421 I235L probably damaging Het
Yipf2 T A 9: 21,590,361 H157L probably damaging Het
Zfp354a A T 11: 51,070,246 H426L probably damaging Het
Zfp503 G T 14: 21,985,485 S454R possibly damaging Het
Zfp619 C T 7: 39,535,400 R285C probably benign Het
Other mutations in Sfmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Sfmbt1 APN 14 30810311 missense probably damaging 1.00
IGL01351:Sfmbt1 APN 14 30769820 missense probably benign 0.00
IGL01478:Sfmbt1 APN 14 30811521 missense probably damaging 1.00
IGL01632:Sfmbt1 APN 14 30817712 missense probably damaging 1.00
IGL02252:Sfmbt1 APN 14 30817733 missense probably damaging 1.00
IGL02456:Sfmbt1 APN 14 30785880 missense probably damaging 0.99
IGL02651:Sfmbt1 APN 14 30815537 missense probably damaging 1.00
IGL02967:Sfmbt1 APN 14 30816802 missense probably damaging 1.00
PIT4142001:Sfmbt1 UTSW 14 30816757 unclassified probably null
PIT4519001:Sfmbt1 UTSW 14 30784191 critical splice donor site probably null
PIT4531001:Sfmbt1 UTSW 14 30796326 missense probably benign 0.00
R0043:Sfmbt1 UTSW 14 30816807 missense probably damaging 0.99
R0389:Sfmbt1 UTSW 14 30811507 missense probably damaging 1.00
R0395:Sfmbt1 UTSW 14 30787617 splice site probably benign
R0562:Sfmbt1 UTSW 14 30811373 intron probably null
R1083:Sfmbt1 UTSW 14 30787541 missense possibly damaging 0.92
R1900:Sfmbt1 UTSW 14 30802567 missense probably damaging 1.00
R2447:Sfmbt1 UTSW 14 30773893 missense possibly damaging 0.62
R3104:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R3105:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R3106:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R4038:Sfmbt1 UTSW 14 30787492 missense probably damaging 1.00
R5118:Sfmbt1 UTSW 14 30790770 missense probably damaging 1.00
R5227:Sfmbt1 UTSW 14 30815254 critical splice donor site probably null
R5286:Sfmbt1 UTSW 14 30816820 missense probably damaging 1.00
R5287:Sfmbt1 UTSW 14 30816820 missense probably damaging 1.00
R5295:Sfmbt1 UTSW 14 30774029 missense probably damaging 1.00
R5620:Sfmbt1 UTSW 14 30784191 critical splice donor site probably null
R6113:Sfmbt1 UTSW 14 30815184 missense possibly damaging 0.68
R6139:Sfmbt1 UTSW 14 30811418 missense probably damaging 1.00
R6429:Sfmbt1 UTSW 14 30773911 missense probably damaging 1.00
R6657:Sfmbt1 UTSW 14 30766096 missense possibly damaging 0.50
R6955:Sfmbt1 UTSW 14 30766034 start gained probably benign
R6957:Sfmbt1 UTSW 14 30787589 missense probably benign 0.00
R7337:Sfmbt1 UTSW 14 30784739 missense possibly damaging 0.62
R7451:Sfmbt1 UTSW 14 30816811 missense probably benign 0.02
R7684:Sfmbt1 UTSW 14 30810354 missense probably damaging 1.00
R7798:Sfmbt1 UTSW 14 30816802 missense probably damaging 1.00
X0064:Sfmbt1 UTSW 14 30815205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACGGCAGAACTTAAGAATTC -3'
(R):5'- AGGACAGAGCAATTCTCAGAAC -3'

Sequencing Primer
(F):5'- GGTTCAAGTCCCAGAGTCCATATAG -3'
(R):5'- CATGTATCCAGAACCATGCGTG -3'
Posted On2019-06-26