Incidental Mutation 'R7206:Ccr6'
ID 560661
Institutional Source Beutler Lab
Gene Symbol Ccr6
Ensembl Gene ENSMUSG00000040899
Gene Name chemokine (C-C motif) receptor 6
Synonyms Cmkbr6
MMRRC Submission 045284-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7206 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 8236043-8257141 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8256949 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 329 (M329L)
Ref Sequence ENSEMBL: ENSMUSP00000095029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097418] [ENSMUST00000164411] [ENSMUST00000166348] [ENSMUST00000167956] [ENSMUST00000177568] [ENSMUST00000180103] [ENSMUST00000231340] [ENSMUST00000231545]
AlphaFold O54689
Predicted Effect probably benign
Transcript: ENSMUST00000097418
AA Change: M329L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095029
Gene: ENSMUSG00000040899
AA Change: M329L

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164411
AA Change: M329L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131153
Gene: ENSMUSG00000040899
AA Change: M329L

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166348
AA Change: M329L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128559
Gene: ENSMUSG00000040899
AA Change: M329L

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167956
AA Change: M329L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128529
Gene: ENSMUSG00000040899
AA Change: M329L

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177568
AA Change: M329L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137249
Gene: ENSMUSG00000040899
AA Change: M329L

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 8.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180103
AA Change: M329L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135945
Gene: ENSMUSG00000040899
AA Change: M329L

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231340
Predicted Effect probably benign
Transcript: ENSMUST00000231545
AA Change: M329L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have decreased inflammatory responses, aberrant trafficking of lymphocytes and dendritic cells, and decreased expression of many inflammatory mediators. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 G A 3: 60,025,241 (GRCm38) M392I probably benign Het
Acr T C 15: 89,574,171 (GRCm38) S352P probably benign Het
Adam6a T C 12: 113,546,034 (GRCm38) C676R probably damaging Het
Adgra3 T C 5: 50,006,896 (GRCm38) D247G probably damaging Het
Agxt2 A T 15: 10,377,456 (GRCm38) E147D probably damaging Het
Atp2a1 T C 7: 126,447,972 (GRCm38) T805A probably benign Het
Atp8b4 T C 2: 126,458,292 (GRCm38) S106G probably damaging Het
Ccdc170 T A 10: 4,514,120 (GRCm38) M87K possibly damaging Het
Ccnl2 T G 4: 155,820,974 (GRCm38) V287G possibly damaging Het
Cflar G T 1: 58,740,991 (GRCm38) M248I Het
Cib4 A T 5: 30,545,766 (GRCm38) L5* probably null Het
Col27a1 A T 4: 63,235,346 (GRCm38) Y645F probably benign Het
Cxcr2 A G 1: 74,159,054 (GRCm38) T236A possibly damaging Het
Dnah12 G A 14: 26,778,912 (GRCm38) probably null Het
Dnah7a A T 1: 53,698,633 (GRCm38) L47* probably null Het
Dnajb6 A C 5: 29,781,337 (GRCm38) K301T possibly damaging Het
Dpf2 T A 19: 5,904,543 (GRCm38) I157F possibly damaging Het
Drd4 G A 7: 141,292,119 (GRCm38) G28R probably damaging Het
Dupd1 A G 14: 21,677,034 (GRCm38) V182A probably damaging Het
Dus3l A T 17: 56,767,807 (GRCm38) I310F probably damaging Het
Eef1akmt3 A G 10: 127,040,993 (GRCm38) L95P probably damaging Het
Fabp7 C T 10: 57,784,991 (GRCm38) probably benign Het
Fam135a T C 1: 24,030,273 (GRCm38) N505S probably benign Het
Fam213a T A 14: 41,004,185 (GRCm38) M12L probably benign Het
Fam216b C A 14: 78,085,127 (GRCm38) D46Y probably damaging Het
Gata6 C T 18: 11,054,850 (GRCm38) R260C probably damaging Het
Gm10800 A AC 2: 98,667,033 (GRCm38) probably null Het
Gm13124 T A 4: 144,558,641 (GRCm38) D142V probably damaging Het
Golgb1 A G 16: 36,913,749 (GRCm38) I1160M probably benign Het
Hfe2 A T 3: 96,528,128 (GRCm38) D234V probably damaging Het
Kiss1 A G 1: 133,327,325 (GRCm38) K26E probably benign Het
Knl1 T A 2: 119,069,299 (GRCm38) F494I probably benign Het
Ktn1 T C 14: 47,695,528 (GRCm38) L713S probably damaging Het
Loxhd1 A G 18: 77,441,817 (GRCm38) D2052G probably damaging Het
Lpo A C 11: 87,807,423 (GRCm38) L582R probably damaging Het
Map2k3 A G 11: 60,943,580 (GRCm38) T125A Het
Matn3 T A 12: 8,961,170 (GRCm38) N360K probably benign Het
Mlip A T 9: 77,164,862 (GRCm38) V237E probably damaging Het
Mms22l T C 4: 24,591,146 (GRCm38) V999A probably benign Het
Mn1 A G 5: 111,420,512 (GRCm38) K783E possibly damaging Het
Myo1h A T 5: 114,319,775 (GRCm38) K132* probably null Het
Nle1 A G 11: 82,904,931 (GRCm38) V230A probably benign Het
Olfr1240 T C 2: 89,440,457 (GRCm38) probably benign Het
Olfr1318 T G 2: 112,156,459 (GRCm38) C169W probably damaging Het
Olfr22-ps1 A T 11: 73,954,821 (GRCm38) I44F probably benign Het
Olfr356 T A 2: 36,937,772 (GRCm38) Y218N probably damaging Het
Olfr564 T C 7: 102,803,684 (GRCm38) S69P probably damaging Het
Olfr860 C T 9: 19,846,560 (GRCm38) D20N probably damaging Het
Ormdl2 T A 10: 128,820,415 (GRCm38) H7L possibly damaging Het
Pam A G 1: 97,896,032 (GRCm38) S225P probably damaging Het
Pan2 C A 10: 128,314,545 (GRCm38) Y719* probably null Het
Ppfia4 T C 1: 134,327,389 (GRCm38) S243G probably benign Het
Ppig T G 2: 69,741,566 (GRCm38) S210A unknown Het
Ppwd1 A T 13: 104,213,598 (GRCm38) N426K probably damaging Het
Rnf10 T G 5: 115,244,121 (GRCm38) D675A probably benign Het
Rrp12 A T 19: 41,878,039 (GRCm38) L619H probably damaging Het
Rsph10b C T 5: 143,961,192 (GRCm38) T497I possibly damaging Het
Scnm1 A T 3: 95,133,894 (GRCm38) M1K probably null Het
Scp2 G T 4: 108,074,441 (GRCm38) D332E probably benign Het
Senp3 T C 11: 69,678,731 (GRCm38) I314V probably benign Het
Sfmbt1 T A 14: 30,811,373 (GRCm38) probably null Het
Slc44a2 T C 9: 21,346,807 (GRCm38) F451S probably damaging Het
Slfn1 A T 11: 83,122,011 (GRCm38) M318L probably benign Het
Syne2 C T 12: 76,004,757 (GRCm38) S4087L probably benign Het
Syt7 A G 19: 10,417,973 (GRCm38) Y49C probably damaging Het
Tas2r134 T C 2: 51,628,108 (GRCm38) Y200H probably benign Het
Tgfbr1 A T 4: 47,402,941 (GRCm38) H315L probably damaging Het
Tmem184c A G 8: 77,596,577 (GRCm38) V552A possibly damaging Het
Tnxb A G 17: 34,704,101 (GRCm38) R2553G possibly damaging Het
Tomm40 C G 7: 19,710,936 (GRCm38) R173S probably benign Het
Tonsl T C 15: 76,633,651 (GRCm38) D650G probably damaging Het
Tpo G C 12: 30,103,134 (GRCm38) S407W possibly damaging Het
Trank1 T C 9: 111,345,515 (GRCm38) probably null Het
Trp53tg5 T C 2: 164,471,458 (GRCm38) E99G probably damaging Het
Tubb2a C A 13: 34,075,522 (GRCm38) S95I possibly damaging Het
Vav2 C A 2: 27,336,719 (GRCm38) R114L probably benign Het
Vmn1r172 A T 7: 23,660,157 (GRCm38) I156L possibly damaging Het
Vmn1r238 A G 18: 3,122,623 (GRCm38) Y264H possibly damaging Het
Vmn2r26 T A 6: 124,039,768 (GRCm38) M397K probably benign Het
Vmn2r73 T C 7: 85,872,867 (GRCm38) N88S probably benign Het
Vps13a T C 19: 16,754,298 (GRCm38) N150S probably damaging Het
Vps35 A T 8: 85,287,721 (GRCm38) Y100N probably damaging Het
Vps8 A C 16: 21,457,421 (GRCm38) I235L probably damaging Het
Yipf2 T A 9: 21,590,361 (GRCm38) H157L probably damaging Het
Zfp354a A T 11: 51,070,246 (GRCm38) H426L probably damaging Het
Zfp503 G T 14: 21,985,485 (GRCm38) S454R possibly damaging Het
Zfp619 C T 7: 39,535,400 (GRCm38) R285C probably benign Het
Other mutations in Ccr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ccr6 APN 17 8,255,993 (GRCm38) missense probably benign 0.07
IGL02227:Ccr6 APN 17 8,256,452 (GRCm38) missense probably damaging 1.00
IGL02339:Ccr6 APN 17 8,256,253 (GRCm38) missense probably benign 0.01
E0374:Ccr6 UTSW 17 8,256,452 (GRCm38) missense probably damaging 1.00
R0021:Ccr6 UTSW 17 8,256,766 (GRCm38) missense possibly damaging 0.46
R0976:Ccr6 UTSW 17 8,256,422 (GRCm38) missense probably damaging 1.00
R0980:Ccr6 UTSW 17 8,256,014 (GRCm38) missense probably benign 0.00
R1141:Ccr6 UTSW 17 8,256,002 (GRCm38) missense probably damaging 1.00
R1674:Ccr6 UTSW 17 8,256,217 (GRCm38) missense probably damaging 0.99
R2117:Ccr6 UTSW 17 8,256,082 (GRCm38) missense possibly damaging 0.75
R2176:Ccr6 UTSW 17 8,256,241 (GRCm38) missense probably damaging 0.99
R4736:Ccr6 UTSW 17 8,256,064 (GRCm38) nonsense probably null
R5050:Ccr6 UTSW 17 8,256,104 (GRCm38) missense probably damaging 1.00
R5786:Ccr6 UTSW 17 8,256,412 (GRCm38) missense probably damaging 0.99
R6138:Ccr6 UTSW 17 8,256,382 (GRCm38) missense probably damaging 1.00
R6856:Ccr6 UTSW 17 8,256,049 (GRCm38) missense probably benign 0.08
R6950:Ccr6 UTSW 17 8,257,066 (GRCm38) makesense probably null
R7102:Ccr6 UTSW 17 8,256,187 (GRCm38) missense probably benign 0.15
R7223:Ccr6 UTSW 17 8,256,140 (GRCm38) missense probably damaging 1.00
R7323:Ccr6 UTSW 17 8,256,779 (GRCm38) missense possibly damaging 0.88
R7737:Ccr6 UTSW 17 8,245,094 (GRCm38) start gained probably benign
R7974:Ccr6 UTSW 17 8,256,224 (GRCm38) missense probably damaging 1.00
R8145:Ccr6 UTSW 17 8,256,113 (GRCm38) missense probably benign 0.16
R8699:Ccr6 UTSW 17 8,256,566 (GRCm38) missense probably benign 0.20
R8738:Ccr6 UTSW 17 8,256,562 (GRCm38) missense probably damaging 0.98
R8983:Ccr6 UTSW 17 8,256,046 (GRCm38) missense probably damaging 1.00
R9242:Ccr6 UTSW 17 8,256,133 (GRCm38) missense probably benign 0.01
R9689:Ccr6 UTSW 17 8,256,989 (GRCm38) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACAGAGCAATCCGAGTCGTG -3'
(R):5'- AATAGCAAGTTTCACCAAGGC -3'

Sequencing Primer
(F):5'- AATCCGAGTCGTGATCGCTG -3'
(R):5'- GCAAGTTTCACCAAGGCTTTTG -3'
Posted On 2019-06-26