Mutagenetix > Incidental Mutations

Incidental Mutation 'R7206:Vps13a'

560669

Institutional Source

Beutler Lab

Gene Symbol

Vps13a

Ensembl Gene

ENSMUSG00000046230

Gene Name

vacuolar protein sorting 13A

Synonyms

4930516E05Rik, 4930543C13Rik, D330038K10Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_173028.4; MGI:2444304

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16615366-16780933 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 16754298 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 150 (N150S)

Ref Sequence

ENSEMBL: ENSMUSP00000068716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]

Predicted Effect

probably damaging
Transcript: ENSMUST00000068156
AA Change: N150S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230
AA Change: N150S

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	5.4e-38	PFAM
Pfam:VPS13	139	371	3.7e-64	PFAM
low complexity region	553	563	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	567	791	1.4e-69	PFAM
Pfam:VPS13_mid_rpt	1138	1329	2e-10	PFAM
low complexity region	1367	1377	N/A	INTRINSIC
Blast:INB	1575	1855	1e-149	BLAST
Pfam:SHR-BD	2200	2449	1.3e-35	PFAM
low complexity region	2510	2521	N/A	INTRINSIC
low complexity region	2632	2648	N/A	INTRINSIC
low complexity region	2719	2731	N/A	INTRINSIC
Pfam:VPS13_C	2755	2935	8.9e-66	PFAM
Pfam:ATG_C	2938	3029	1.6e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000224149
AA Change: N150S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (87/88)

MGI Phenotype

Strain: 3531502
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl2	G	A	3: 60,025,241	M392I	probably benign	Het
Acr	T	C	15: 89,574,171	S352P	probably benign	Het
Adam6a	T	C	12: 113,546,034	C676R	probably damaging	Het
Adgra3	T	C	5: 50,006,896	D247G	probably damaging	Het
Agxt2	A	T	15: 10,377,456	E147D	probably damaging	Het
Atp2a1	T	C	7: 126,447,972	T805A	probably benign	Het
Atp8b4	T	C	2: 126,458,292	S106G	probably damaging	Het
Ccdc170	T	A	10: 4,514,120	M87K	possibly damaging	Het
Ccnl2	T	G	4: 155,820,974	V287G	possibly damaging	Het
Ccr6	A	T	17: 8,256,949	M329L	probably benign	Het
Cflar	G	T	1: 58,740,991	M248I		Het
Cib4	A	T	5: 30,545,766	L5*	probably null	Het
Col27a1	A	T	4: 63,235,346	Y645F	probably benign	Het
Cxcr2	A	G	1: 74,159,054	T236A	possibly damaging	Het
Dnah12	G	A	14: 26,778,912		probably null	Het
Dnah7a	A	T	1: 53,698,633	L47*	probably null	Het
Dnajb6	A	C	5: 29,781,337	K301T	possibly damaging	Het
Dpf2	T	A	19: 5,904,543	I157F	possibly damaging	Het
Drd4	G	A	7: 141,292,119	G28R	probably damaging	Het
Dupd1	A	G	14: 21,677,034	V182A	probably damaging	Het
Dus3l	A	T	17: 56,767,807	I310F	probably damaging	Het
Eef1akmt3	A	G	10: 127,040,993	L95P	probably damaging	Het
Fabp7	C	T	10: 57,784,991		probably benign	Het
Fam135a	T	C	1: 24,030,273	N505S	probably benign	Het
Fam213a	T	A	14: 41,004,185	M12L	probably benign	Het
Fam216b	C	A	14: 78,085,127	D46Y	probably damaging	Het
Gata6	C	T	18: 11,054,850	R260C	probably damaging	Het
Gm10800	A	AC	2: 98,667,033		probably null	Het
Gm13124	T	A	4: 144,558,641	D142V	probably damaging	Het
Golgb1	A	G	16: 36,913,749	I1160M	probably benign	Het
Hfe2	A	T	3: 96,528,128	D234V	probably damaging	Het
Kiss1	A	G	1: 133,327,325	K26E	probably benign	Het
Knl1	T	A	2: 119,069,299	F494I	probably benign	Het
Ktn1	T	C	14: 47,695,528	L713S	probably damaging	Het
Loxhd1	A	G	18: 77,441,817	D2052G	probably damaging	Het
Lpo	A	C	11: 87,807,423	L582R	probably damaging	Het
Map2k3	A	G	11: 60,943,580	T125A		Het
Matn3	T	A	12: 8,961,170	N360K	probably benign	Het
Mlip	A	T	9: 77,164,862	V237E	probably damaging	Het
Mms22l	T	C	4: 24,591,146	V999A	probably benign	Het
Mn1	A	G	5: 111,420,512	K783E	possibly damaging	Het
Myo1h	A	T	5: 114,319,775	K132*	probably null	Het
Nle1	A	G	11: 82,904,931	V230A	probably benign	Het
Olfr1240	T	C	2: 89,440,457		probably benign	Het
Olfr1318	T	G	2: 112,156,459	C169W	probably damaging	Het
Olfr22-ps1	A	T	11: 73,954,821	I44F	probably benign	Het
Olfr356	T	A	2: 36,937,772	Y218N	probably damaging	Het
Olfr564	T	C	7: 102,803,684	S69P	probably damaging	Het
Olfr860	C	T	9: 19,846,560	D20N	probably damaging	Het
Ormdl2	T	A	10: 128,820,415	H7L	possibly damaging	Het
Pam	A	G	1: 97,896,032	S225P	probably damaging	Het
Pan2	C	A	10: 128,314,545	Y719*	probably null	Het
Ppfia4	T	C	1: 134,327,389	S243G	probably benign	Het
Ppig	T	G	2: 69,741,566	S210A	unknown	Het
Ppwd1	A	T	13: 104,213,598	N426K	probably damaging	Het
Rnf10	T	G	5: 115,244,121	D675A	probably benign	Het
Rrp12	A	T	19: 41,878,039	L619H	probably damaging	Het
Rsph10b	C	T	5: 143,961,192	T497I	possibly damaging	Het
Scnm1	A	T	3: 95,133,894	M1K	probably null	Het
Scp2	G	T	4: 108,074,441	D332E	probably benign	Het
Senp3	T	C	11: 69,678,731	I314V	probably benign	Het
Sfmbt1	T	A	14: 30,811,373		probably null	Het
Slc44a2	T	C	9: 21,346,807	F451S	probably damaging	Het
Slfn1	A	T	11: 83,122,011	M318L	probably benign	Het
Syne2	C	T	12: 76,004,757	S4087L	probably benign	Het
Syt7	A	G	19: 10,417,973	Y49C	probably damaging	Het
Tas2r134	T	C	2: 51,628,108	Y200H	probably benign	Het
Tgfbr1	A	T	4: 47,402,941	H315L	probably damaging	Het
Tmem184c	A	G	8: 77,596,577	V552A	possibly damaging	Het
Tnxb	A	G	17: 34,704,101	R2553G	possibly damaging	Het
Tomm40	C	G	7: 19,710,936	R173S	probably benign	Het
Tonsl	T	C	15: 76,633,651	D650G	probably damaging	Het
Tpo	G	C	12: 30,103,134	S407W	possibly damaging	Het
Trank1	T	C	9: 111,345,515		probably null	Het
Trp53tg5	T	C	2: 164,471,458	E99G	probably damaging	Het
Tubb2a	C	A	13: 34,075,522	S95I	possibly damaging	Het
Vav2	C	A	2: 27,336,719	R114L	probably benign	Het
Vmn1r172	A	T	7: 23,660,157	I156L	possibly damaging	Het
Vmn1r238	A	G	18: 3,122,623	Y264H	possibly damaging	Het
Vmn2r26	T	A	6: 124,039,768	M397K	probably benign	Het
Vmn2r73	T	C	7: 85,872,867	N88S	probably benign	Het
Vps35	A	T	8: 85,287,721	Y100N	probably damaging	Het
Vps8	A	C	16: 21,457,421	I235L	probably damaging	Het
Yipf2	T	A	9: 21,590,361	H157L	probably damaging	Het
Zfp354a	A	T	11: 51,070,246	H426L	probably damaging	Het
Zfp503	G	T	14: 21,985,485	S454R	possibly damaging	Het
Zfp619	C	T	7: 39,535,400	R285C	probably benign	Het

Other mutations in Vps13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Vps13a	APN	19	16752175	missense	probably damaging	0.98
IGL00537:Vps13a	APN	19	16680045	missense	probably benign	0.03
IGL00562:Vps13a	APN	19	16734714	critical splice donor site	probably null
IGL00563:Vps13a	APN	19	16734714	critical splice donor site	probably null
IGL00579:Vps13a	APN	19	16707362	missense	probably benign	0.29
IGL00662:Vps13a	APN	19	16704540	missense	probably damaging	0.96
IGL00667:Vps13a	APN	19	16759676	missense	probably damaging	1.00
IGL01102:Vps13a	APN	19	16651417	critical splice donor site	probably null
IGL01139:Vps13a	APN	19	16640625	missense	probably damaging	0.99
IGL01142:Vps13a	APN	19	16687115	missense	possibly damaging	0.86
IGL01361:Vps13a	APN	19	16743007	missense	probably damaging	1.00
IGL01386:Vps13a	APN	19	16701152	missense	possibly damaging	0.87
IGL01593:Vps13a	APN	19	16762181	missense	probably damaging	0.98
IGL01700:Vps13a	APN	19	16744857	nonsense	probably null
IGL01767:Vps13a	APN	19	16663894	missense	probably damaging	1.00
IGL01782:Vps13a	APN	19	16754337	missense	probably damaging	0.98
IGL01808:Vps13a	APN	19	16710286	missense	probably damaging	1.00
IGL01812:Vps13a	APN	19	16715060	missense	probably benign
IGL01829:Vps13a	APN	19	16619443	missense	probably benign	0.01
IGL01893:Vps13a	APN	19	16663775	missense	probably damaging	1.00
IGL02222:Vps13a	APN	19	16682175	missense	probably benign	0.06
IGL02295:Vps13a	APN	19	16715042	splice site	probably benign
IGL02465:Vps13a	APN	19	16710941	missense	probably benign	0.11
IGL02492:Vps13a	APN	19	16647637	missense	probably damaging	1.00
IGL02581:Vps13a	APN	19	16655322	missense	probably benign	0.41
IGL02633:Vps13a	APN	19	16720408	missense	possibly damaging	0.82
IGL02641:Vps13a	APN	19	16698821	missense	probably benign	0.01
IGL02659:Vps13a	APN	19	16652699	missense	probably damaging	1.00
IGL02827:Vps13a	APN	19	16641634	missense	possibly damaging	0.91
IGL02943:Vps13a	APN	19	16663886	missense	probably damaging	1.00
IGL03057:Vps13a	APN	19	16668694	missense	probably damaging	1.00
IGL03077:Vps13a	APN	19	16710882	missense	probably benign
IGL03184:Vps13a	APN	19	16654370	missense	probably benign	0.00
eggs	UTSW	19	16701165	missense	probably damaging	1.00
excambio	UTSW	19	16745947	splice site	probably null
Ham	UTSW	19	16677969	missense	probably benign	0.08
interchange	UTSW	19	16668690	missense	probably damaging	1.00
PIT4377001:Vps13a	UTSW	19	16740901	missense	probably damaging	1.00
R0045:Vps13a	UTSW	19	16640810	nonsense	probably null
R0045:Vps13a	UTSW	19	16640810	nonsense	probably null
R0048:Vps13a	UTSW	19	16676140	missense	probably damaging	1.00
R0062:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R0062:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R0107:Vps13a	UTSW	19	16691824	missense	probably benign	0.03
R0135:Vps13a	UTSW	19	16780765	missense	probably damaging	1.00
R0138:Vps13a	UTSW	19	16660499	missense	possibly damaging	0.95
R0346:Vps13a	UTSW	19	16677969	missense	probably benign	0.08
R0359:Vps13a	UTSW	19	16641577	missense	probably damaging	0.99
R0530:Vps13a	UTSW	19	16655206	splice site	probably benign
R0541:Vps13a	UTSW	19	16704577	missense	probably benign	0.00
R0614:Vps13a	UTSW	19	16652694	missense	probably damaging	1.00
R0685:Vps13a	UTSW	19	16780741	missense	probably damaging	1.00
R0801:Vps13a	UTSW	19	16686656	splice site	probably benign
R0835:Vps13a	UTSW	19	16734882	intron	probably null
R0848:Vps13a	UTSW	19	16698897	missense	probably damaging	1.00
R1114:Vps13a	UTSW	19	16750151	missense	probably benign	0.41
R1205:Vps13a	UTSW	19	16640541	missense	probably damaging	1.00
R1365:Vps13a	UTSW	19	16619446	missense	probably damaging	1.00
R1445:Vps13a	UTSW	19	16701238	nonsense	probably null
R1451:Vps13a	UTSW	19	16710864	missense	probably benign	0.01
R1479:Vps13a	UTSW	19	16750114	splice site	probably benign
R1533:Vps13a	UTSW	19	16701130	nonsense	probably null
R1600:Vps13a	UTSW	19	16666272	missense	probably benign	0.01
R1870:Vps13a	UTSW	19	16759952	missense	probably damaging	1.00
R1871:Vps13a	UTSW	19	16664664	missense	probably benign	0.01
R1959:Vps13a	UTSW	19	16677938	missense	possibly damaging	0.49
R1960:Vps13a	UTSW	19	16725631	missense	probably damaging	1.00
R1993:Vps13a	UTSW	19	16722458	missense	probably benign	0.07
R2257:Vps13a	UTSW	19	16682174	missense	possibly damaging	0.85
R2276:Vps13a	UTSW	19	16710426	missense	possibly damaging	0.47
R2326:Vps13a	UTSW	19	16743057	missense	possibly damaging	0.71
R2338:Vps13a	UTSW	19	16720453	missense	probably damaging	1.00
R2359:Vps13a	UTSW	19	16652679	splice site	probably benign
R2421:Vps13a	UTSW	19	16759671	missense	probably benign
R2847:Vps13a	UTSW	19	16703599	missense	probably damaging	0.98
R3081:Vps13a	UTSW	19	16664737	missense	probably benign	0.02
R3522:Vps13a	UTSW	19	16766493	splice site	probably benign
R3613:Vps13a	UTSW	19	16685402	missense	probably damaging	1.00
R3797:Vps13a	UTSW	19	16745947	splice site	probably null
R3874:Vps13a	UTSW	19	16744953	missense	probably benign	0.01
R4032:Vps13a	UTSW	19	16616899	missense	probably damaging	1.00
R4111:Vps13a	UTSW	19	16640628	missense	probably damaging	1.00
R4383:Vps13a	UTSW	19	16701165	missense	probably damaging	1.00
R4504:Vps13a	UTSW	19	16695502	missense	possibly damaging	0.93
R4578:Vps13a	UTSW	19	16682110	missense	probably damaging	0.98
R4587:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4588:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4605:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4714:Vps13a	UTSW	19	16749856	missense	probably benign	0.01
R4756:Vps13a	UTSW	19	16655216	missense	probably benign	0.01
R4831:Vps13a	UTSW	19	16677992	missense	probably benign	0.04
R5068:Vps13a	UTSW	19	16746058	missense	probably benign	0.01
R5070:Vps13a	UTSW	19	16654484	missense	probably benign
R5082:Vps13a	UTSW	19	16744893	missense	probably damaging	1.00
R5182:Vps13a	UTSW	19	16695499	missense	possibly damaging	0.81
R5189:Vps13a	UTSW	19	16685315	missense	probably damaging	1.00
R5283:Vps13a	UTSW	19	16677970	missense	probably damaging	0.96
R5294:Vps13a	UTSW	19	16641667	missense	probably damaging	1.00
R5304:Vps13a	UTSW	19	16710387	missense	possibly damaging	0.78
R5554:Vps13a	UTSW	19	16722411	missense	probably damaging	1.00
R5592:Vps13a	UTSW	19	16725571	missense	probably damaging	1.00
R5611:Vps13a	UTSW	19	16725572	missense	probably damaging	1.00
R5665:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R5671:Vps13a	UTSW	19	16715100	missense	probably benign	0.03
R5684:Vps13a	UTSW	19	16699045	missense	probably benign	0.00
R5767:Vps13a	UTSW	19	16664564	missense	probably damaging	1.00
R5810:Vps13a	UTSW	19	16666324	missense	probably benign	0.00
R5866:Vps13a	UTSW	19	16680023	missense	probably benign	0.04
R5886:Vps13a	UTSW	19	16664562	missense	probably benign	0.01
R5933:Vps13a	UTSW	19	16660530	missense	probably benign	0.34
R5965:Vps13a	UTSW	19	16619028	intron	probably null
R6259:Vps13a	UTSW	19	16687170	nonsense	probably null
R6346:Vps13a	UTSW	19	16682214	missense	possibly damaging	0.94
R6459:Vps13a	UTSW	19	16664018	missense	possibly damaging	0.56
R6485:Vps13a	UTSW	19	16680050	missense	probably damaging	0.99
R6520:Vps13a	UTSW	19	16725579	missense	probably damaging	1.00
R6644:Vps13a	UTSW	19	16744919	missense	possibly damaging	0.90
R6932:Vps13a	UTSW	19	16678075	missense	probably benign	0.01
R6934:Vps13a	UTSW	19	16676194	missense	probably damaging	1.00
R6951:Vps13a	UTSW	19	16723740	missense	probably benign	0.00
R7027:Vps13a	UTSW	19	16664664	missense	probably benign	0.01
R7126:Vps13a	UTSW	19	16710879	missense	probably benign
R7248:Vps13a	UTSW	19	16678042	missense	probably benign	0.25
R7252:Vps13a	UTSW	19	16661064	missense	probably benign	0.00
R7255:Vps13a	UTSW	19	16654339	critical splice donor site	probably null
R7382:Vps13a	UTSW	19	16619485	missense	probably damaging	1.00
R7422:Vps13a	UTSW	19	16750173	missense	probably damaging	1.00
R7425:Vps13a	UTSW	19	16723702	missense	probably benign	0.13
R7523:Vps13a	UTSW	19	16703789	missense	probably benign
R7586:Vps13a	UTSW	19	16647598	missense	probably benign	0.08
R7587:Vps13a	UTSW	19	16703789	missense	probably benign	0.00
R7593:Vps13a	UTSW	19	16725663	missense	probably damaging	1.00
R7637:Vps13a	UTSW	19	16750149	missense	probably benign	0.02
R7763:Vps13a	UTSW	19	16746000	missense	possibly damaging	0.95
R7813:Vps13a	UTSW	19	16651456	missense	possibly damaging	0.81
R7815:Vps13a	UTSW	19	16725572	missense	probably damaging	1.00
X0061:Vps13a	UTSW	19	16645868	missense	probably benign	0.40
X0066:Vps13a	UTSW	19	16742553	missense	probably benign	0.33
Z31818:Vps13a	UTSW	19	16780754	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGCCTTCATAACTCAACGTTCAAAC -3'
(R):5'- CACAGTTGGCTGCAGTCTAATG -3'

Sequencing Primer
(F):5'- ACTCAACGTTCAAACAGTTTAGC -3'
(R):5'- TGAGACAGGAAGCTAGCTTTTAAAC -3'

Posted On

2019-06-26