Incidental Mutation 'R7207:A2ml1'
ID560696
Institutional Source Beutler Lab
Gene Symbol A2ml1
Ensembl Gene ENSMUSG00000047228
Gene Namealpha-2-macroglobulin like 1
Synonyms
Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7207 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location128539821-128581608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128550771 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1019 (Y1019H)
Ref Sequence ENSEMBL: ENSMUSP00000059426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060574]
Predicted Effect probably benign
Transcript: ENSMUST00000060574
AA Change: Y1019H

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: Y1019H

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
Pfam:A2M_N 120 213 6.3e-17 PFAM
A2M_N_2 448 594 2.95e-37 SMART
A2M 736 826 2.11e-33 SMART
Pfam:Thiol-ester_cl 959 988 3.1e-17 PFAM
Pfam:A2M_comp 1008 1255 2.3e-71 PFAM
A2M_recep 1361 1447 1.22e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 C A 11: 102,772,057 A212D probably benign Het
Adamts13 C A 2: 26,978,695 H230Q probably damaging Het
Adgrl3 G A 5: 81,310,027 M1I probably null Het
Agap1 A T 1: 89,843,099 H657L possibly damaging Het
Ano3 T C 2: 110,781,423 D238G probably damaging Het
Atp8b5 A T 4: 43,357,018 I589F probably damaging Het
Bmp1 C T 14: 70,479,560 A859T possibly damaging Het
Cdh20 C A 1: 104,993,977 D666E probably damaging Het
Cep135 T G 5: 76,632,243 D807E probably benign Het
Cldn13 G A 5: 134,914,912 H140Y probably benign Het
Cnksr1 G T 4: 134,235,123 Q155K possibly damaging Het
Col1a1 G A 11: 94,938,526 R121Q unknown Het
Coro6 G A 11: 77,467,263 A225T possibly damaging Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Dhrs7b C A 11: 60,855,797 Y237* probably null Het
Dnah3 A G 7: 119,971,089 F2303L probably damaging Het
Dsg2 T A 18: 20,601,459 D831E probably damaging Het
Dst T C 1: 34,163,337 S575P probably damaging Het
Epg5 T C 18: 77,948,955 L289P probably damaging Het
Etl4 A G 2: 20,709,576 N162S probably damaging Het
Fbf1 A T 11: 116,149,474 Y602N probably benign Het
Fgd4 A T 16: 16,484,556 M45K probably benign Het
Fryl C T 5: 73,065,095 V2048I probably benign Het
Gm13119 A G 4: 144,361,903 T90A probably benign Het
Gulp1 T C 1: 44,766,132 V127A possibly damaging Het
H2-DMb1 T A 17: 34,157,516 I203N probably damaging Het
Harbi1 T C 2: 91,712,445 S84P probably damaging Het
Hrh2 T C 13: 54,214,247 S81P possibly damaging Het
Iars T C 13: 49,688,315 probably null Het
Kcnma1 T C 14: 23,309,015 *1087W probably null Het
Lama5 T A 2: 180,207,084 N241I probably damaging Het
Lig4 T A 8: 9,972,101 K560* probably null Het
Lpin3 G T 2: 160,894,003 E68* probably null Het
Mkl2 A T 16: 13,326,436 I7L probably benign Het
Msrb3 A T 10: 120,791,400 probably null Het
Muc5b A G 7: 141,862,865 T3183A probably benign Het
Mx1 T A 16: 97,452,198 D342V probably benign Het
Nrap G T 19: 56,345,521 T1003K probably damaging Het
Olfr1037 A G 2: 86,084,815 S321P possibly damaging Het
Plxna2 C T 1: 194,644,019 P87L probably damaging Het
Pms2 C T 5: 143,913,634 T89I probably damaging Het
Ppp1r12c C A 7: 4,489,868 R203L probably damaging Het
Rab44 C T 17: 29,138,039 Q48* probably null Het
Rgs14 T C 13: 55,383,234 V417A probably benign Het
Sgms1 T A 19: 32,142,747 K253M probably null Het
Sidt2 T C 9: 45,945,151 Y492C probably damaging Het
Slco1a5 G T 6: 142,248,749 Y389* probably null Het
Slfn14 G A 11: 83,279,388 Q477* probably null Het
Sorbs3 T C 14: 70,201,485 K142R probably damaging Het
Sphk1 A T 11: 116,535,764 D182V probably damaging Het
Srsf9 C G 5: 115,327,422 Y38* probably null Het
Stk40 A C 4: 126,125,754 E107A probably damaging Het
Syngr4 T C 7: 45,888,677 Y89C possibly damaging Het
Tead1 G A 7: 112,842,080 R109H possibly damaging Het
Thra A G 11: 98,760,976 Q108R probably damaging Het
Tnni3k G A 3: 154,875,145 T621I probably damaging Het
Trim3 A C 7: 105,613,376 V525G possibly damaging Het
Usp49 T C 17: 47,678,877 V529A probably benign Het
Vill A T 9: 119,071,213 Q849L possibly damaging Het
Vps36 T A 8: 22,211,607 S237T probably benign Het
Zar1l A T 5: 150,507,093 C284* probably null Het
Zfp948 T C 17: 21,588,340 V598A possibly damaging Het
Zfp952 T C 17: 33,003,515 Y323H possibly damaging Het
Other mutations in A2ml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:A2ml1 APN 6 128578156 missense possibly damaging 0.78
IGL00596:A2ml1 APN 6 128570067 missense probably damaging 0.99
IGL00912:A2ml1 APN 6 128552307 missense probably benign 0.04
IGL01320:A2ml1 APN 6 128575588 missense probably benign 0.00
IGL01470:A2ml1 APN 6 128580412 missense probably damaging 0.96
IGL01576:A2ml1 APN 6 128554330 splice site probably benign
IGL01761:A2ml1 APN 6 128546337 missense possibly damaging 0.61
IGL01792:A2ml1 APN 6 128560679 missense probably benign 0.04
IGL01843:A2ml1 APN 6 128553338 splice site probably benign
IGL01946:A2ml1 APN 6 128570479 missense possibly damaging 0.81
IGL02016:A2ml1 APN 6 128558335 missense probably damaging 1.00
IGL02170:A2ml1 APN 6 128547210 missense possibly damaging 0.58
IGL02269:A2ml1 APN 6 128553338 splice site probably benign
IGL02589:A2ml1 APN 6 128581500 missense probably benign 0.00
IGL02959:A2ml1 APN 6 128567060 missense probably benign 0.04
IGL02970:A2ml1 APN 6 128569979 missense probably damaging 1.00
IGL03206:A2ml1 APN 6 128553276 missense possibly damaging 0.50
IGL03298:A2ml1 APN 6 128543960 missense probably benign 0.00
1mM(1):A2ml1 UTSW 6 128580960 missense probably benign 0.02
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0128:A2ml1 UTSW 6 128575639 splice site probably benign
R0299:A2ml1 UTSW 6 128553232 splice site probably benign
R0523:A2ml1 UTSW 6 128558326 missense possibly damaging 0.92
R0565:A2ml1 UTSW 6 128568743 nonsense probably null
R0599:A2ml1 UTSW 6 128552245 missense probably damaging 1.00
R0626:A2ml1 UTSW 6 128550773 missense probably damaging 0.99
R0732:A2ml1 UTSW 6 128546448 missense probably damaging 1.00
R0880:A2ml1 UTSW 6 128560646 missense possibly damaging 0.49
R1070:A2ml1 UTSW 6 128543300 missense probably damaging 1.00
R1166:A2ml1 UTSW 6 128570917 missense probably benign 0.00
R1278:A2ml1 UTSW 6 128558507 missense probably damaging 1.00
R1421:A2ml1 UTSW 6 128543960 missense probably benign 0.00
R1536:A2ml1 UTSW 6 128547233 nonsense probably null
R1786:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R1808:A2ml1 UTSW 6 128543299 missense probably damaging 1.00
R1813:A2ml1 UTSW 6 128566273 missense probably benign 0.34
R1863:A2ml1 UTSW 6 128550783 missense probably damaging 0.99
R2007:A2ml1 UTSW 6 128542892 missense probably benign 0.13
R2062:A2ml1 UTSW 6 128552308 missense probably benign 0.08
R2127:A2ml1 UTSW 6 128558437 missense probably damaging 1.00
R2130:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2131:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2201:A2ml1 UTSW 6 128547305 missense probably null 0.34
R2319:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2321:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2322:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2369:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2370:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2371:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2372:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2375:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2893:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2894:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3438:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3615:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3616:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3773:A2ml1 UTSW 6 128555083 missense probably benign 0.02
R3785:A2ml1 UTSW 6 128544924 critical splice donor site probably null
R3803:A2ml1 UTSW 6 128545070 missense probably benign 0.17
R3824:A2ml1 UTSW 6 128568763 missense probably damaging 0.99
R3878:A2ml1 UTSW 6 128554361 missense probably benign 0.05
R4176:A2ml1 UTSW 6 128545037 missense possibly damaging 0.68
R4229:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4230:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4348:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4351:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4352:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4353:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4427:A2ml1 UTSW 6 128545046 missense probably benign 0.00
R4971:A2ml1 UTSW 6 128547227 missense probably damaging 0.98
R5014:A2ml1 UTSW 6 128543933 missense probably benign 0.00
R5369:A2ml1 UTSW 6 128568833 missense probably damaging 0.97
R5532:A2ml1 UTSW 6 128553330 critical splice acceptor site probably null
R5860:A2ml1 UTSW 6 128541061 missense probably benign 0.15
R5872:A2ml1 UTSW 6 128561526 missense probably damaging 1.00
R5926:A2ml1 UTSW 6 128560645 missense probably benign
R5977:A2ml1 UTSW 6 128581122 missense probably damaging 1.00
R5980:A2ml1 UTSW 6 128567055 missense possibly damaging 0.82
R6014:A2ml1 UTSW 6 128571985 missense probably damaging 1.00
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6061:A2ml1 UTSW 6 128568712 missense probably damaging 1.00
R6327:A2ml1 UTSW 6 128558692 splice site probably null
R6331:A2ml1 UTSW 6 128552236 missense probably damaging 0.96
R6465:A2ml1 UTSW 6 128541078 missense probably damaging 1.00
R6640:A2ml1 UTSW 6 128553285 missense probably benign 0.41
R6792:A2ml1 UTSW 6 128546329 nonsense probably null
R6793:A2ml1 UTSW 6 128546329 nonsense probably null
R7378:A2ml1 UTSW 6 128546247 critical splice donor site probably null
R7556:A2ml1 UTSW 6 128569964 missense probably damaging 1.00
R8010:A2ml1 UTSW 6 128580340 missense probably benign 0.08
R8017:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8019:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8035:A2ml1 UTSW 6 128553280 missense probably damaging 0.99
R8094:A2ml1 UTSW 6 128572082 missense probably damaging 1.00
R8144:A2ml1 UTSW 6 128569999 missense possibly damaging 0.84
R8365:A2ml1 UTSW 6 128580955 nonsense probably null
R8382:A2ml1 UTSW 6 128560682 missense probably benign 0.01
R8388:A2ml1 UTSW 6 128571974 missense probably benign 0.03
R8717:A2ml1 UTSW 6 128566995 missense probably benign 0.00
R8947:A2ml1 UTSW 6 128552256 missense probably damaging 1.00
RF014:A2ml1 UTSW 6 128570068 missense probably damaging 0.96
X0063:A2ml1 UTSW 6 128572012 missense probably benign
Z1176:A2ml1 UTSW 6 128571977 missense probably benign 0.09
Z1177:A2ml1 UTSW 6 128545076 missense probably benign
Z1177:A2ml1 UTSW 6 128561616 nonsense probably null
Z1177:A2ml1 UTSW 6 128575607 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AACAAAGGGCTTTCTCCTCAATTTC -3'
(R):5'- AGAGCTGAACAACCTGGAGTTTC -3'

Sequencing Primer
(F):5'- TTTAAATTCACGTACATCCCGATCAC -3'
(R):5'- CTGGAGTTTCAGGGACCAACAC -3'
Posted On2019-06-26