Incidental Mutation 'R7207:Syngr4'
ID560699
Institutional Source Beutler Lab
Gene Symbol Syngr4
Ensembl Gene ENSMUSG00000040231
Gene Namesynaptogyrin 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7207 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45885222-45896714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45888677 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 89 (Y89C)
Ref Sequence ENSEMBL: ENSMUSP00000047035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002855] [ENSMUST00000039049] [ENSMUST00000120299] [ENSMUST00000211716]
Predicted Effect probably benign
Transcript: ENSMUST00000002855
SMART Domains Protein: ENSMUSP00000002855
Gene: ENSMUSG00000002778

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Pfam:ER_lumen_recept 28 169 7.5e-58 PFAM
transmembrane domain 178 200 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000039049
AA Change: Y89C

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047035
Gene: ENSMUSG00000040231
AA Change: Y89C

DomainStartEndE-ValueType
Pfam:MARVEL 18 163 2e-27 PFAM
low complexity region 184 201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120299
AA Change: Y89C

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113955
Gene: ENSMUSG00000040231
AA Change: Y89C

DomainStartEndE-ValueType
Pfam:MARVEL 18 110 2.3e-12 PFAM
low complexity region 113 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211716
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein. The gene belongs to the synaptogyrin gene family. Like other members of the family the protein contains four transmembrane regions. The exact function of this protein is unclear. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,550,771 Y1019H probably benign Het
Adam11 C A 11: 102,772,057 A212D probably benign Het
Adamts13 C A 2: 26,978,695 H230Q probably damaging Het
Adgrl3 G A 5: 81,310,027 M1I probably null Het
Agap1 A T 1: 89,843,099 H657L possibly damaging Het
Ano3 T C 2: 110,781,423 D238G probably damaging Het
Atp8b5 A T 4: 43,357,018 I589F probably damaging Het
Bmp1 C T 14: 70,479,560 A859T possibly damaging Het
Cdh20 C A 1: 104,993,977 D666E probably damaging Het
Cep135 T G 5: 76,632,243 D807E probably benign Het
Cldn13 G A 5: 134,914,912 H140Y probably benign Het
Cnksr1 G T 4: 134,235,123 Q155K possibly damaging Het
Col1a1 G A 11: 94,938,526 R121Q unknown Het
Coro6 G A 11: 77,467,263 A225T possibly damaging Het
Ctse C A 1: 131,664,374 T146K possibly damaging Het
Dhrs7b C A 11: 60,855,797 Y237* probably null Het
Dnah3 A G 7: 119,971,089 F2303L probably damaging Het
Dsg2 T A 18: 20,601,459 D831E probably damaging Het
Dst T C 1: 34,163,337 S575P probably damaging Het
Epg5 T C 18: 77,948,955 L289P probably damaging Het
Etl4 A G 2: 20,709,576 N162S probably damaging Het
Fbf1 A T 11: 116,149,474 Y602N probably benign Het
Fgd4 A T 16: 16,484,556 M45K probably benign Het
Fryl C T 5: 73,065,095 V2048I probably benign Het
Gm13119 A G 4: 144,361,903 T90A probably benign Het
Gulp1 T C 1: 44,766,132 V127A possibly damaging Het
H2-DMb1 T A 17: 34,157,516 I203N probably damaging Het
Harbi1 T C 2: 91,712,445 S84P probably damaging Het
Hrh2 T C 13: 54,214,247 S81P possibly damaging Het
Iars T C 13: 49,688,315 probably null Het
Kcnma1 T C 14: 23,309,015 *1087W probably null Het
Lama5 T A 2: 180,207,084 N241I probably damaging Het
Lig4 T A 8: 9,972,101 K560* probably null Het
Lpin3 G T 2: 160,894,003 E68* probably null Het
Mkl2 A T 16: 13,326,436 I7L probably benign Het
Msrb3 A T 10: 120,791,400 probably null Het
Muc5b A G 7: 141,862,865 T3183A probably benign Het
Mx1 T A 16: 97,452,198 D342V probably benign Het
Nrap G T 19: 56,345,521 T1003K probably damaging Het
Olfr1037 A G 2: 86,084,815 S321P possibly damaging Het
Plxna2 C T 1: 194,644,019 P87L probably damaging Het
Pms2 C T 5: 143,913,634 T89I probably damaging Het
Ppp1r12c C A 7: 4,489,868 R203L probably damaging Het
Rab44 C T 17: 29,138,039 Q48* probably null Het
Rgs14 T C 13: 55,383,234 V417A probably benign Het
Sgms1 T A 19: 32,142,747 K253M probably null Het
Sidt2 T C 9: 45,945,151 Y492C probably damaging Het
Slco1a5 G T 6: 142,248,749 Y389* probably null Het
Slfn14 G A 11: 83,279,388 Q477* probably null Het
Sorbs3 T C 14: 70,201,485 K142R probably damaging Het
Sphk1 A T 11: 116,535,764 D182V probably damaging Het
Srsf9 C G 5: 115,327,422 Y38* probably null Het
Stk40 A C 4: 126,125,754 E107A probably damaging Het
Tead1 G A 7: 112,842,080 R109H possibly damaging Het
Thra A G 11: 98,760,976 Q108R probably damaging Het
Tnni3k G A 3: 154,875,145 T621I probably damaging Het
Trim3 A C 7: 105,613,376 V525G possibly damaging Het
Usp49 T C 17: 47,678,877 V529A probably benign Het
Vill A T 9: 119,071,213 Q849L possibly damaging Het
Vps36 T A 8: 22,211,607 S237T probably benign Het
Zar1l A T 5: 150,507,093 C284* probably null Het
Zfp948 T C 17: 21,588,340 V598A possibly damaging Het
Zfp952 T C 17: 33,003,515 Y323H possibly damaging Het
Other mutations in Syngr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Syngr4 APN 7 45886966 missense probably benign
R1739:Syngr4 UTSW 7 45888722 missense possibly damaging 0.95
R2143:Syngr4 UTSW 7 45887040 missense probably benign 0.01
R2144:Syngr4 UTSW 7 45887040 missense probably benign 0.01
R2145:Syngr4 UTSW 7 45887040 missense probably benign 0.01
R3740:Syngr4 UTSW 7 45895770 missense possibly damaging 0.94
R3741:Syngr4 UTSW 7 45895770 missense possibly damaging 0.94
R3742:Syngr4 UTSW 7 45895770 missense possibly damaging 0.94
R4627:Syngr4 UTSW 7 45887028 missense probably damaging 1.00
R6709:Syngr4 UTSW 7 45888698 missense probably benign 0.02
R6767:Syngr4 UTSW 7 45887491 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- ATGCTTCCAGGAGGAGTCATC -3'
(R):5'- GGGCACTGATGTCTACCCTTTC -3'

Sequencing Primer
(F):5'- AGTCATCAGGCACAGGTTTG -3'
(R):5'- TCCATTGTGGTTCACAGGTC -3'
Posted On2019-06-26