Mutagenetix > Incidental Mutations

Incidental Mutation 'R7207:Bmp1'

560722

Institutional Source

Beutler Lab

Gene Symbol

Bmp1

Ensembl Gene

ENSMUSG00000022098

Gene Name

bone morphogenetic protein 1

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7207 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70474558-70520234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70479560 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 859 (A859T)

Ref Sequence

ENSEMBL: ENSMUSP00000022693 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226906] [ENSMUST00000227944]

AlphaFold

P98063

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022693
AA Change: A859T

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: A859T

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
ZnMc	131	273	1.32e-54	SMART
CUB	327	439	4.35e-43	SMART
CUB	440	552	7.86e-50	SMART
EGF_CA	552	593	5.03e-11	SMART
CUB	596	708	1.13e-50	SMART
EGF_CA	708	748	4.81e-8	SMART
CUB	752	864	3.99e-51	SMART
CUB	865	981	7.35e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226906

Predicted Effect

probably benign
Transcript: ENSMUST00000227944

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	G	6: 128,550,771	Y1019H	probably benign	Het
Adam11	C	A	11: 102,772,057	A212D	probably benign	Het
Adamts13	C	A	2: 26,978,695	H230Q	probably damaging	Het
Adgrl3	G	A	5: 81,310,027	M1I	probably null	Het
Agap1	A	T	1: 89,843,099	H657L	possibly damaging	Het
Ano3	T	C	2: 110,781,423	D238G	probably damaging	Het
Atp8b5	A	T	4: 43,357,018	I589F	probably damaging	Het
Cdh20	C	A	1: 104,993,977	D666E	probably damaging	Het
Cep135	T	G	5: 76,632,243	D807E	probably benign	Het
Cldn13	G	A	5: 134,914,912	H140Y	probably benign	Het
Cnksr1	G	T	4: 134,235,123	Q155K	possibly damaging	Het
Col1a1	G	A	11: 94,938,526	R121Q	unknown	Het
Coro6	G	A	11: 77,467,263	A225T	possibly damaging	Het
Ctse	C	A	1: 131,664,374	T146K	possibly damaging	Het
Dhrs7b	C	A	11: 60,855,797	Y237*	probably null	Het
Dnah3	A	G	7: 119,971,089	F2303L	probably damaging	Het
Dsg2	T	A	18: 20,601,459	D831E	probably damaging	Het
Dst	T	C	1: 34,163,337	S575P	probably damaging	Het
Epg5	T	C	18: 77,948,955	L289P	probably damaging	Het
Etl4	A	G	2: 20,709,576	N162S	probably damaging	Het
Fbf1	A	T	11: 116,149,474	Y602N	probably benign	Het
Fgd4	A	T	16: 16,484,556	M45K	probably benign	Het
Fryl	C	T	5: 73,065,095	V2048I	probably benign	Het
Gm13119	A	G	4: 144,361,903	T90A	probably benign	Het
Gulp1	T	C	1: 44,766,132	V127A	possibly damaging	Het
H2-DMb1	T	A	17: 34,157,516	I203N	probably damaging	Het
Harbi1	T	C	2: 91,712,445	S84P	probably damaging	Het
Hrh2	T	C	13: 54,214,247	S81P	possibly damaging	Het
Iars	T	C	13: 49,688,315		probably null	Het
Kcnma1	T	C	14: 23,309,015	*1087W	probably null	Het
Lama5	T	A	2: 180,207,084	N241I	probably damaging	Het
Lig4	T	A	8: 9,972,101	K560*	probably null	Het
Lpin3	G	T	2: 160,894,003	E68*	probably null	Het
Mkl2	A	T	16: 13,326,436	I7L	probably benign	Het
Msrb3	A	T	10: 120,791,400		probably null	Het
Muc5b	A	G	7: 141,862,865	T3183A	probably benign	Het
Mx1	T	A	16: 97,452,198	D342V	probably benign	Het
Nrap	G	T	19: 56,345,521	T1003K	probably damaging	Het
Olfr1037	A	G	2: 86,084,815	S321P	possibly damaging	Het
Plxna2	C	T	1: 194,644,019	P87L	probably damaging	Het
Pms2	C	T	5: 143,913,634	T89I	probably damaging	Het
Ppp1r12c	C	A	7: 4,489,868	R203L	probably damaging	Het
Rab44	C	T	17: 29,138,039	Q48*	probably null	Het
Rgs14	T	C	13: 55,383,234	V417A	probably benign	Het
Sgms1	T	A	19: 32,142,747	K253M	probably null	Het
Sidt2	T	C	9: 45,945,151	Y492C	probably damaging	Het
Slco1a5	G	T	6: 142,248,749	Y389*	probably null	Het
Slfn14	G	A	11: 83,279,388	Q477*	probably null	Het
Sorbs3	T	C	14: 70,201,485	K142R	probably damaging	Het
Sphk1	A	T	11: 116,535,764	D182V	probably damaging	Het
Srsf9	C	G	5: 115,327,422	Y38*	probably null	Het
Stk40	A	C	4: 126,125,754	E107A	probably damaging	Het
Syngr4	T	C	7: 45,888,677	Y89C	possibly damaging	Het
Tead1	G	A	7: 112,842,080	R109H	possibly damaging	Het
Thra	A	G	11: 98,760,976	Q108R	probably damaging	Het
Tnni3k	G	A	3: 154,875,145	T621I	probably damaging	Het
Trim3	A	C	7: 105,613,376	V525G	possibly damaging	Het
Usp49	T	C	17: 47,678,877	V529A	probably benign	Het
Vill	A	T	9: 119,071,213	Q849L	possibly damaging	Het
Vps36	T	A	8: 22,211,607	S237T	probably benign	Het
Zar1l	A	T	5: 150,507,093	C284*	probably null	Het
Zfp948	T	C	17: 21,588,340	V598A	possibly damaging	Het
Zfp952	T	C	17: 33,003,515	Y323H	possibly damaging	Het

Other mutations in Bmp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Bmp1	APN	14	70492461	missense	probably damaging	1.00
IGL02065:Bmp1	APN	14	70486220	missense	probably damaging	0.97
IGL02065:Bmp1	APN	14	70490107	missense	probably damaging	0.99
IGL02349:Bmp1	APN	14	70507549	missense	possibly damaging	0.61
IGL02486:Bmp1	APN	14	70504776	missense	possibly damaging	0.48
PIT4519001:Bmp1	UTSW	14	70490029	missense	possibly damaging	0.65
R0394:Bmp1	UTSW	14	70490034	missense	probably damaging	0.99
R1371:Bmp1	UTSW	14	70492466	missense	probably damaging	1.00
R1604:Bmp1	UTSW	14	70508004	missense	possibly damaging	0.66
R1732:Bmp1	UTSW	14	70486265	missense	possibly damaging	0.67
R1834:Bmp1	UTSW	14	70508831	missense	possibly damaging	0.73
R2008:Bmp1	UTSW	14	70492466	missense	probably damaging	1.00
R2197:Bmp1	UTSW	14	70486272	missense	possibly damaging	0.83
R3157:Bmp1	UTSW	14	70492107	missense	possibly damaging	0.63
R4397:Bmp1	UTSW	14	70490542	splice site	probably null
R4609:Bmp1	UTSW	14	70477966	missense	probably benign	0.00
R4613:Bmp1	UTSW	14	70508523	missense	probably damaging	1.00
R4675:Bmp1	UTSW	14	70492844	missense	probably damaging	0.99
R4796:Bmp1	UTSW	14	70492073	splice site	probably null
R4884:Bmp1	UTSW	14	70475215	missense	probably benign	0.01
R4905:Bmp1	UTSW	14	70491362	missense	probably benign	0.06
R5088:Bmp1	UTSW	14	70486219	missense	possibly damaging	0.84
R5225:Bmp1	UTSW	14	70480165	missense	probably damaging	0.97
R5271:Bmp1	UTSW	14	70508128	missense	probably benign	0.34
R5625:Bmp1	UTSW	14	70486166	missense	probably benign	0.19
R5653:Bmp1	UTSW	14	70490094	missense	probably benign	0.00
R6155:Bmp1	UTSW	14	70508007	missense	probably damaging	1.00
R6295:Bmp1	UTSW	14	70491383	missense	possibly damaging	0.88
R6618:Bmp1	UTSW	14	70491368	missense	probably damaging	1.00
R6649:Bmp1	UTSW	14	70490618	missense	probably damaging	1.00
R6653:Bmp1	UTSW	14	70490618	missense	probably damaging	1.00
R6951:Bmp1	UTSW	14	70508858	missense	probably benign	0.26
R6983:Bmp1	UTSW	14	70508207	missense	probably damaging	0.96
R7500:Bmp1	UTSW	14	70490122	missense	probably benign	0.44
R7716:Bmp1	UTSW	14	70477922	nonsense	probably null
R7749:Bmp1	UTSW	14	70492844	missense	probably damaging	1.00
R7763:Bmp1	UTSW	14	70492084	missense	probably damaging	1.00
R7834:Bmp1	UTSW	14	70508565	missense	probably damaging	1.00
R8232:Bmp1	UTSW	14	70519889	missense	probably damaging	0.97
R8490:Bmp1	UTSW	14	70490133	missense	possibly damaging	0.94
R8827:Bmp1	UTSW	14	70490642	missense	probably damaging	1.00
R8945:Bmp1	UTSW	14	70490190	missense	probably damaging	1.00
R9178:Bmp1	UTSW	14	70490173	missense	possibly damaging	0.78
R9228:Bmp1	UTSW	14	70519898	missense	probably benign
X0028:Bmp1	UTSW	14	70508537	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCCCTGAGTGTTCACTCC -3'
(R):5'- GAGATGGATATTGAGTCTCAGCCC -3'

Sequencing Primer
(F):5'- CGATGATCTCGTCCTCAGAAC -3'
(R):5'- ATATTGAGTCTCAGCCCGAGTG -3'

Posted On

2019-06-26