Incidental Mutation 'R7203:Cubn'
ID560740
Institutional Source Beutler Lab
Gene Symbol Cubn
Ensembl Gene ENSMUSG00000026726
Gene Namecubilin (intrinsic factor-cobalamin receptor)
SynonymsD2Wsu88e
MMRRC Submission
Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7203 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location13276338-13491813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 13351003 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 1806 (H1806P)
Ref Sequence ENSEMBL: ENSMUSP00000089009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091436]
Predicted Effect probably benign
Transcript: ENSMUST00000091436
AA Change: H1806P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: H1806P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 132 165 2.14e-5 SMART
EGF_CA 167 208 1.95e-8 SMART
EGF 213 258 2.85e-1 SMART
EGF_CA 260 301 2.66e-10 SMART
EGF_CA 302 345 7.07e-6 SMART
EGF 349 393 1.01e-1 SMART
EGF 398 430 3.73e-5 SMART
EGF_CA 432 468 8.63e-10 SMART
CUB 474 586 4.4e-21 SMART
CUB 590 702 3.82e-39 SMART
CUB 708 816 3.66e-18 SMART
CUB 817 928 3.09e-25 SMART
CUB 932 1042 1.29e-36 SMART
CUB 1048 1161 3.46e-37 SMART
CUB 1165 1277 7.24e-40 SMART
CUB 1278 1389 8.33e-31 SMART
CUB 1391 1506 3.08e-43 SMART
CUB 1510 1619 1.9e-34 SMART
CUB 1620 1734 7.24e-40 SMART
CUB 1738 1850 6.02e-37 SMART
CUB 1852 1963 1.57e-26 SMART
CUB 1978 2091 3.46e-28 SMART
CUB 2092 2213 2.88e-34 SMART
CUB 2217 2334 4.13e-35 SMART
CUB 2336 2448 3.1e-39 SMART
CUB 2452 2565 5.37e-34 SMART
CUB 2570 2687 3e-23 SMART
CUB 2689 2801 3.1e-39 SMART
CUB 2805 2919 2.36e-21 SMART
CUB 2920 3035 6.18e-25 SMART
CUB 3037 3150 5.16e-36 SMART
CUB 3157 3274 1.68e-35 SMART
CUB 3278 3393 7.17e-12 SMART
CUB 3395 3507 2.49e-29 SMART
CUB 3511 3623 2.4e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (108/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,953,333 V184A probably benign Het
4932415D10Rik G A 10: 82,293,414 T1254I probably benign Het
Aars2 A G 17: 45,516,571 Y513C probably damaging Het
Ackr2 G A 9: 121,908,967 C136Y probably damaging Het
Aldh1l1 A G 6: 90,570,800 K414R probably benign Het
Arl9 A G 5: 77,007,271 Y83C possibly damaging Het
Atp10a G T 7: 58,786,473 R337L probably benign Het
Atp6v1g3 A T 1: 138,287,800 Q66L probably damaging Het
Atp7b A T 8: 21,997,335 N1321K probably damaging Het
Axdnd1 A T 1: 156,382,389 M437K probably damaging Het
Bap1 C A 14: 31,254,169 P147Q probably damaging Het
Bicd1 C T 6: 149,512,905 T372I possibly damaging Het
Brix1 T C 15: 10,483,292 probably null Het
Btrc A G 19: 45,513,528 probably null Het
C130050O18Rik A C 5: 139,414,374 I61L probably benign Het
Cfap161 A G 7: 83,776,050 S278P probably damaging Het
Cgnl1 T C 9: 71,724,533 D512G possibly damaging Het
Chat T C 14: 32,419,057 D461G probably damaging Het
Chl1 T A 6: 103,691,674 V456D probably benign Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Dapk1 T A 13: 60,696,335 V56E possibly damaging Het
Dennd4a A G 9: 64,896,474 N1032D probably benign Het
Dlg5 T A 14: 24,138,655 E1756V probably damaging Het
Dnah1 T C 14: 31,274,382 T2666A probably benign Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah6 T A 6: 73,173,545 E745V probably benign Het
Dock8 A T 19: 25,181,563 N1695I probably damaging Het
Esf1 C T 2: 140,164,219 R336Q possibly damaging Het
Fam161a A G 11: 23,021,664 probably null Het
Fam89a T C 8: 124,751,679 E44G possibly damaging Het
Fndc3b A T 3: 27,456,485 D829E probably benign Het
Fxr1 C T 3: 34,046,540 T125I possibly damaging Het
Gfer T C 17: 24,695,862 D69G probably damaging Het
Gm16486 A T 8: 70,716,948 E1229V probably benign Het
Gm2000 A T 1: 156,366,087 I4F probably damaging Het
Gpatch2l T A 12: 86,288,937 S471T probably benign Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gsn A G 2: 35,298,795 I447V probably benign Het
H2al2c C T Y: 2,599,234 L46F possibly damaging Het
Hao2 A C 3: 98,877,282 probably null Het
Ifitm10 T C 7: 142,328,568 E155G probably benign Het
Igkv8-16 C A 6: 70,386,810 W76L probably benign Het
Igsf21 A T 4: 140,107,337 F75I possibly damaging Het
Ints14 T A 9: 64,964,419 M13K probably damaging Het
Ipmk A T 10: 71,363,468 D53V possibly damaging Het
Itga8 A G 2: 12,230,095 F451L possibly damaging Het
Jup A G 11: 100,381,734 F284S probably damaging Het
Kctd5 T C 17: 24,073,235 D65G probably benign Het
Klrc1 A T 6: 129,677,221 S148T probably benign Het
Kmt5b A G 19: 3,814,147 K404E probably damaging Het
Krt9 A C 11: 100,190,791 M304R probably damaging Het
Krtap5-1 A T 7: 142,296,562 S143T unknown Het
Kyat3 A G 3: 142,720,401 N68D probably damaging Het
Kynu A G 2: 43,681,353 D427G probably damaging Het
Leo1 A G 9: 75,445,996 probably null Het
Loxhd1 A G 18: 77,414,196 D1737G probably damaging Het
Lpo C A 11: 87,809,251 L521F possibly damaging Het
Lrrk1 A G 7: 66,270,825 S1477P probably damaging Het
Lrrtm1 C A 6: 77,243,601 L14M probably damaging Het
Ly75 G A 2: 60,323,852 R1084* probably null Het
Mcf2l A G 8: 13,010,456 D764G probably benign Het
Mrgprd A T 7: 145,322,349 D319V probably benign Het
Mut A T 17: 40,938,673 M180L probably benign Het
Myom3 T C 4: 135,795,179 L897P possibly damaging Het
Ncapd2 A T 6: 125,184,328 M247K possibly damaging Het
Nlrp2 T C 7: 5,317,534 D868G probably damaging Het
Npy6r A G 18: 44,275,932 N140S probably damaging Het
Nsmce4a T C 7: 130,539,872 K196E probably benign Het
Nup88 T C 11: 70,945,254 K532R probably benign Het
Olfr424 T A 1: 174,137,114 Y123* probably null Het
Olfr947-ps1 A T 9: 39,289,293 I199N unknown Het
Olfr974 T A 9: 39,942,509 V83E probably benign Het
Pbxip1 A T 3: 89,447,428 D418V possibly damaging Het
Pde2a C A 7: 101,509,944 R761S possibly damaging Het
Phf10 A T 17: 14,946,313 C432S probably damaging Het
Pitpnm2 T C 5: 124,121,459 D1271G probably damaging Het
Plin1 A T 7: 79,723,444 L259Q probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pou6f2 T A 13: 18,239,794 Q132L unknown Het
Ppa2 A T 3: 133,330,438 N118Y possibly damaging Het
Prickle2 T C 6: 92,410,978 E537G possibly damaging Het
Prl3d1 A G 13: 27,098,701 I141V possibly damaging Het
Prl8a1 A T 13: 27,574,189 V179D probably damaging Het
Prr14l A G 5: 32,827,145 F1669L probably benign Het
Prrg4 T A 2: 104,839,442 E110V possibly damaging Het
Rfx5 C A 3: 94,958,876 H495Q unknown Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rpe65 A G 3: 159,622,854 Y433C probably damaging Het
Rtn4rl1 C T 11: 75,265,750 S336F possibly damaging Het
Scn2a A G 2: 65,748,319 D1446G probably benign Het
Sdk1 C A 5: 142,046,176 T1002K probably benign Het
Slc9b2 T C 3: 135,330,661 S409P probably benign Het
Sowahc A G 10: 59,222,278 T79A probably benign Het
Stk35 T A 2: 129,801,593 C166S probably benign Het
Tarbp2 A G 15: 102,522,487 H225R probably benign Het
Tdrd12 T A 7: 35,489,223 K530* probably null Het
Terf2ip A G 8: 112,017,986 I312V probably benign Het
Tgfb1 T C 7: 25,692,539 probably null Het
Thbs2 T C 17: 14,671,458 D939G probably damaging Het
Ube4b A T 4: 149,398,610 I67K probably benign Het
Ubn1 G T 16: 5,077,216 V709F possibly damaging Het
Ugt2b5 T C 5: 87,128,399 K339E possibly damaging Het
Vax2 T C 6: 83,737,900 S266P probably damaging Het
Vmn2r108 A G 17: 20,462,776 I722T probably benign Het
Vmn2r95 A G 17: 18,441,315 K441R probably benign Het
Wapl C A 14: 34,736,691 D903E probably benign Het
Wee1 T A 7: 110,134,794 V442D probably benign Het
Zan T C 5: 137,434,096 N2313S unknown Het
Other mutations in Cubn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cubn APN 2 13491820 unclassified probably benign
IGL00228:Cubn APN 2 13456697 missense probably damaging 1.00
IGL00231:Cubn APN 2 13381849 missense possibly damaging 0.89
IGL00327:Cubn APN 2 13427056 missense possibly damaging 0.73
IGL00470:Cubn APN 2 13278418 missense probably benign 0.00
IGL00519:Cubn APN 2 13282919 missense probably benign 0.00
IGL00562:Cubn APN 2 13294230 missense probably benign 0.01
IGL00678:Cubn APN 2 13467710 missense possibly damaging 0.47
IGL00834:Cubn APN 2 13381927 missense probably damaging 1.00
IGL00946:Cubn APN 2 13456623 missense probably damaging 0.98
IGL00971:Cubn APN 2 13278408 missense possibly damaging 0.77
IGL01124:Cubn APN 2 13478093 missense possibly damaging 0.62
IGL01287:Cubn APN 2 13310566 missense probably damaging 1.00
IGL01410:Cubn APN 2 13465908 missense probably benign 0.31
IGL01418:Cubn APN 2 13284041 missense probably benign 0.01
IGL01450:Cubn APN 2 13350862 splice site probably benign
IGL01534:Cubn APN 2 13465933 nonsense probably null
IGL01584:Cubn APN 2 13308661 splice site probably benign
IGL01595:Cubn APN 2 13325216 missense probably benign 0.05
IGL01625:Cubn APN 2 13306274 missense possibly damaging 0.76
IGL01732:Cubn APN 2 13489936 nonsense probably null
IGL01972:Cubn APN 2 13446072 missense possibly damaging 0.90
IGL02027:Cubn APN 2 13287594 missense probably damaging 1.00
IGL02033:Cubn APN 2 13339846 missense probably damaging 0.98
IGL02124:Cubn APN 2 13381837 missense probably damaging 0.99
IGL02335:Cubn APN 2 13427834 splice site probably null
IGL02491:Cubn APN 2 13321228 missense probably damaging 1.00
IGL02686:Cubn APN 2 13325226 missense possibly damaging 0.92
IGL02707:Cubn APN 2 13446032 missense probably damaging 0.99
IGL02746:Cubn APN 2 13445040 missense probably damaging 1.00
IGL02873:Cubn APN 2 13294370 missense probably benign 0.07
IGL02897:Cubn APN 2 13318312 missense possibly damaging 0.55
IGL03078:Cubn APN 2 13287094 missense possibly damaging 0.87
IGL03245:Cubn APN 2 13355689 missense probably benign 0.09
IGL03289:Cubn APN 2 13426967 missense probably benign 0.00
IGL03335:Cubn APN 2 13360329 missense probably damaging 1.00
IGL03355:Cubn APN 2 13478057 splice site probably null
mellow UTSW 2 13478078 missense probably damaging 1.00
PIT4354001:Cubn UTSW 2 13468852 nonsense probably null
PIT4495001:Cubn UTSW 2 13491750 missense probably benign 0.00
R0145:Cubn UTSW 2 13306432 missense probably damaging 1.00
R0220:Cubn UTSW 2 13356709 missense probably damaging 1.00
R0254:Cubn UTSW 2 13424694 missense probably benign 0.01
R0254:Cubn UTSW 2 13440514 missense possibly damaging 0.84
R0254:Cubn UTSW 2 13476035 critical splice donor site probably null
R0360:Cubn UTSW 2 13310507 splice site probably benign
R0364:Cubn UTSW 2 13310507 splice site probably benign
R0383:Cubn UTSW 2 13430959 missense probably damaging 1.00
R0419:Cubn UTSW 2 13469763 missense possibly damaging 0.77
R0419:Cubn UTSW 2 13469764 missense possibly damaging 0.87
R0498:Cubn UTSW 2 13444267 missense probably damaging 0.99
R0560:Cubn UTSW 2 13428680 missense probably damaging 1.00
R0615:Cubn UTSW 2 13360252 splice site probably null
R0735:Cubn UTSW 2 13491689 splice site probably benign
R0780:Cubn UTSW 2 13456613 missense probably damaging 1.00
R0899:Cubn UTSW 2 13362328 missense possibly damaging 0.54
R1118:Cubn UTSW 2 13336242 missense possibly damaging 0.78
R1182:Cubn UTSW 2 13445000 missense probably damaging 0.98
R1439:Cubn UTSW 2 13287568 missense probably damaging 0.96
R1450:Cubn UTSW 2 13360319 missense probably damaging 1.00
R1464:Cubn UTSW 2 13325288 missense possibly damaging 0.87
R1464:Cubn UTSW 2 13325288 missense possibly damaging 0.87
R1476:Cubn UTSW 2 13476120 missense probably benign 0.04
R1508:Cubn UTSW 2 13427105 missense probably benign 0.25
R1532:Cubn UTSW 2 13287661 missense probably damaging 1.00
R1562:Cubn UTSW 2 13427967 missense probably damaging 1.00
R1598:Cubn UTSW 2 13469789 missense probably benign 0.00
R1761:Cubn UTSW 2 13489317 critical splice donor site probably null
R1862:Cubn UTSW 2 13308561 missense probably damaging 1.00
R1874:Cubn UTSW 2 13323002 missense probably damaging 1.00
R1923:Cubn UTSW 2 13310526 missense probably damaging 1.00
R1944:Cubn UTSW 2 13278538 missense probably benign 0.01
R1960:Cubn UTSW 2 13340017 splice site probably null
R2021:Cubn UTSW 2 13308549 missense probably benign 0.09
R2137:Cubn UTSW 2 13336167 missense probably benign 0.01
R2138:Cubn UTSW 2 13444378 missense probably damaging 0.99
R2139:Cubn UTSW 2 13336167 missense probably benign 0.01
R2179:Cubn UTSW 2 13318242 missense possibly damaging 0.85
R2328:Cubn UTSW 2 13404080 nonsense probably null
R2369:Cubn UTSW 2 13491217 missense probably damaging 1.00
R2428:Cubn UTSW 2 13476150 missense probably damaging 1.00
R2435:Cubn UTSW 2 13318272 missense probably damaging 1.00
R2567:Cubn UTSW 2 13278356 splice site probably null
R2850:Cubn UTSW 2 13322953 missense probably damaging 1.00
R2853:Cubn UTSW 2 13430834 missense probably benign 0.00
R2893:Cubn UTSW 2 13358139 missense possibly damaging 0.61
R3107:Cubn UTSW 2 13362347 missense possibly damaging 0.73
R3109:Cubn UTSW 2 13362347 missense possibly damaging 0.73
R3119:Cubn UTSW 2 13358162 missense possibly damaging 0.90
R3405:Cubn UTSW 2 13333508 missense probably benign 0.00
R3703:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3704:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3705:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3764:Cubn UTSW 2 13331585 missense possibly damaging 0.79
R3792:Cubn UTSW 2 13427914 missense probably damaging 1.00
R3802:Cubn UTSW 2 13360353 missense probably benign 0.01
R3813:Cubn UTSW 2 13294325 missense probably damaging 1.00
R3845:Cubn UTSW 2 13283008 missense probably damaging 1.00
R3846:Cubn UTSW 2 13283008 missense probably damaging 1.00
R3900:Cubn UTSW 2 13286980 critical splice donor site probably null
R3921:Cubn UTSW 2 13326677 missense probably damaging 1.00
R4075:Cubn UTSW 2 13313999 missense possibly damaging 0.58
R4082:Cubn UTSW 2 13428563 intron probably benign
R4405:Cubn UTSW 2 13466030 missense probably damaging 1.00
R4615:Cubn UTSW 2 13428749 missense probably damaging 1.00
R4629:Cubn UTSW 2 13313979 splice site probably null
R4770:Cubn UTSW 2 13314767 missense possibly damaging 0.92
R4799:Cubn UTSW 2 13287024 missense possibly damaging 0.94
R4799:Cubn UTSW 2 13351058 missense probably damaging 1.00
R4812:Cubn UTSW 2 13459076 missense probably damaging 1.00
R4825:Cubn UTSW 2 13325225 missense probably damaging 1.00
R4934:Cubn UTSW 2 13489910 missense probably benign 0.06
R4967:Cubn UTSW 2 13348045 missense probably benign 0.01
R5187:Cubn UTSW 2 13287568 missense probably damaging 0.96
R5232:Cubn UTSW 2 13478202 nonsense probably null
R5305:Cubn UTSW 2 13388939 missense probably damaging 1.00
R5506:Cubn UTSW 2 13491695 splice site probably null
R5530:Cubn UTSW 2 13308523 missense probably damaging 1.00
R5531:Cubn UTSW 2 13350932 missense probably benign 0.00
R5737:Cubn UTSW 2 13388891 missense probably damaging 1.00
R5886:Cubn UTSW 2 13320023 splice site probably benign
R5923:Cubn UTSW 2 13486078 missense possibly damaging 0.73
R6032:Cubn UTSW 2 13325184 missense probably benign 0.12
R6032:Cubn UTSW 2 13325184 missense probably benign 0.12
R6084:Cubn UTSW 2 13430897 missense probably damaging 1.00
R6087:Cubn UTSW 2 13427847 missense probably damaging 1.00
R6133:Cubn UTSW 2 13308618 missense probably benign 0.29
R6181:Cubn UTSW 2 13349876 missense probably benign 0.31
R6301:Cubn UTSW 2 13478078 missense probably damaging 1.00
R6320:Cubn UTSW 2 13280195 missense probably damaging 1.00
R6368:Cubn UTSW 2 13430995 missense probably damaging 0.96
R6368:Cubn UTSW 2 13476123 missense probably damaging 0.98
R6383:Cubn UTSW 2 13427835 critical splice donor site probably null
R6393:Cubn UTSW 2 13355680 missense probably benign 0.08
R6408:Cubn UTSW 2 13294203 missense probably damaging 1.00
R6470:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R6532:Cubn UTSW 2 13459002 missense probably benign 0.01
R6599:Cubn UTSW 2 13310673 missense possibly damaging 0.95
R6629:Cubn UTSW 2 13430872 missense probably damaging 1.00
R6641:Cubn UTSW 2 13476064 missense probably damaging 1.00
R6800:Cubn UTSW 2 13321255 missense probably damaging 1.00
R6823:Cubn UTSW 2 13445029 missense probably benign 0.21
R6847:Cubn UTSW 2 13444253 critical splice donor site probably null
R6885:Cubn UTSW 2 13318278 missense probably damaging 1.00
R6962:Cubn UTSW 2 13348029 missense probably benign 0.03
R6973:Cubn UTSW 2 13381837 missense possibly damaging 0.61
R6975:Cubn UTSW 2 13486789 missense probably damaging 0.99
R7076:Cubn UTSW 2 13306280 missense probably benign 0.00
R7076:Cubn UTSW 2 13306281 missense probably benign 0.10
R7086:Cubn UTSW 2 13319858 missense probably damaging 0.98
R7162:Cubn UTSW 2 13342498 missense probably damaging 0.96
R7292:Cubn UTSW 2 13424739 missense probably damaging 0.99
R7307:Cubn UTSW 2 13340332 missense probably damaging 0.99
R7329:Cubn UTSW 2 13468771 missense probably damaging 0.99
R7395:Cubn UTSW 2 13287064 missense probably damaging 1.00
R7417:Cubn UTSW 2 13426967 missense probably benign 0.00
R7429:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R7430:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R7443:Cubn UTSW 2 13455509 missense probably damaging 1.00
R7699:Cubn UTSW 2 13348178 missense probably benign
R7699:Cubn UTSW 2 13489917 missense possibly damaging 0.74
R7700:Cubn UTSW 2 13348178 missense probably benign
R7700:Cubn UTSW 2 13489917 missense possibly damaging 0.74
X0018:Cubn UTSW 2 13458986 missense probably damaging 1.00
X0022:Cubn UTSW 2 13476076 missense probably damaging 1.00
X0026:Cubn UTSW 2 13342581 missense probably damaging 1.00
X0063:Cubn UTSW 2 13322962 missense probably damaging 1.00
YA93:Cubn UTSW 2 13383992 missense probably benign 0.21
Z1088:Cubn UTSW 2 13294229 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CAAGCACACTTTTCTTTGCCATCAG -3'
(R):5'- TTTTCCTTACTCCAGAAGGATATCC -3'

Sequencing Primer
(F):5'- ACACTTTTCTTTGCCATCAGTGATC -3'
(R):5'- AGATCCTTCCAGTTGGAG -3'
Posted On2019-06-26