Mutagenetix > Incidental Mutation

Incidental Mutation 'R7203:Cubn'

560740

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin (intrinsic factor-cobalamin receptor)

Synonyms

D2Wsu88e

MMRRC Submission

045281-MU

Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7203 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13276338-13491813 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 13351003 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Proline at position 1806 (H1806P)

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000091436
AA Change: H1806P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: H1806P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (108/108)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544G11Rik	T	C	6: 65,953,333	V184A	probably benign	Het
4932415D10Rik	G	A	10: 82,293,414	T1254I	probably benign	Het
Aars2	A	G	17: 45,516,571	Y513C	probably damaging	Het
Ackr2	G	A	9: 121,908,967	C136Y	probably damaging	Het
Aldh1l1	A	G	6: 90,570,800	K414R	probably benign	Het
Arl9	A	G	5: 77,007,271	Y83C	possibly damaging	Het
Atp10a	G	T	7: 58,786,473	R337L	probably benign	Het
Atp6v1g3	A	T	1: 138,287,800	Q66L	probably damaging	Het
Atp7b	A	T	8: 21,997,335	N1321K	probably damaging	Het
Axdnd1	A	T	1: 156,382,389	M437K	probably damaging	Het
Bap1	C	A	14: 31,254,169	P147Q	probably damaging	Het
Bicd1	C	T	6: 149,512,905	T372I	possibly damaging	Het
Brix1	T	C	15: 10,483,292		probably null	Het
Btrc	A	G	19: 45,513,528		probably null	Het
C130050O18Rik	A	C	5: 139,414,374	I61L	probably benign	Het
Cfap161	A	G	7: 83,776,050	S278P	probably damaging	Het
Cgnl1	T	C	9: 71,724,533	D512G	possibly damaging	Het
Chat	T	C	14: 32,419,057	D461G	probably damaging	Het
Chl1	T	A	6: 103,691,674	V456D	probably benign	Het
Cib1	T	C	7: 80,232,372	T20A	possibly damaging	Het
Dapk1	T	A	13: 60,696,335	V56E	possibly damaging	Het
Dennd4a	A	G	9: 64,896,474	N1032D	probably benign	Het
Dlg5	T	A	14: 24,138,655	E1756V	probably damaging	Het
Dnah1	T	C	14: 31,274,382	T2666A	probably benign	Het
Dnah11	A	T	12: 118,045,522	I2135N	possibly damaging	Het
Dnah6	T	A	6: 73,173,545	E745V	probably benign	Het
Dock8	A	T	19: 25,181,563	N1695I	probably damaging	Het
Esf1	C	T	2: 140,164,219	R336Q	possibly damaging	Het
Fam161a	A	G	11: 23,021,664		probably null	Het
Fam89a	T	C	8: 124,751,679	E44G	possibly damaging	Het
Fndc3b	A	T	3: 27,456,485	D829E	probably benign	Het
Fxr1	C	T	3: 34,046,540	T125I	possibly damaging	Het
Gfer	T	C	17: 24,695,862	D69G	probably damaging	Het
Gm16486	A	T	8: 70,716,948	E1229V	probably benign	Het
Gm2000	A	T	1: 156,366,087	I4F	probably damaging	Het
Gpatch2l	T	A	12: 86,288,937	S471T	probably benign	Het
Grm7	T	G	6: 111,358,569	I647S	possibly damaging	Het
Gsn	A	G	2: 35,298,795	I447V	probably benign	Het
H2al2c	C	T	Y: 2,599,234	L46F	possibly damaging	Het
Hao2	A	C	3: 98,877,282		probably null	Het
Ifitm10	T	C	7: 142,328,568	E155G	probably benign	Het
Igkv8-16	C	A	6: 70,386,810	W76L	probably benign	Het
Igsf21	A	T	4: 140,107,337	F75I	possibly damaging	Het
Ints14	T	A	9: 64,964,419	M13K	probably damaging	Het
Ipmk	A	T	10: 71,363,468	D53V	possibly damaging	Het
Itga8	A	G	2: 12,230,095	F451L	possibly damaging	Het
Jup	A	G	11: 100,381,734	F284S	probably damaging	Het
Kctd5	T	C	17: 24,073,235	D65G	probably benign	Het
Klrc1	A	T	6: 129,677,221	S148T	probably benign	Het
Kmt5b	A	G	19: 3,814,147	K404E	probably damaging	Het
Krt9	A	C	11: 100,190,791	M304R	probably damaging	Het
Krtap5-1	A	T	7: 142,296,562	S143T	unknown	Het
Kyat3	A	G	3: 142,720,401	N68D	probably damaging	Het
Kynu	A	G	2: 43,681,353	D427G	probably damaging	Het
Leo1	A	G	9: 75,445,996		probably null	Het
Loxhd1	A	G	18: 77,414,196	D1737G	probably damaging	Het
Lpo	C	A	11: 87,809,251	L521F	possibly damaging	Het
Lrrk1	A	G	7: 66,270,825	S1477P	probably damaging	Het
Lrrtm1	C	A	6: 77,243,601	L14M	probably damaging	Het
Ly75	G	A	2: 60,323,852	R1084*	probably null	Het
Mcf2l	A	G	8: 13,010,456	D764G	probably benign	Het
Mrgprd	A	T	7: 145,322,349	D319V	probably benign	Het
Mut	A	T	17: 40,938,673	M180L	probably benign	Het
Myom3	T	C	4: 135,795,179	L897P	possibly damaging	Het
Ncapd2	A	T	6: 125,184,328	M247K	possibly damaging	Het
Nlrp2	T	C	7: 5,317,534	D868G	probably damaging	Het
Npy6r	A	G	18: 44,275,932	N140S	probably damaging	Het
Nsmce4a	T	C	7: 130,539,872	K196E	probably benign	Het
Nup88	T	C	11: 70,945,254	K532R	probably benign	Het
Olfr424	T	A	1: 174,137,114	Y123*	probably null	Het
Olfr947-ps1	A	T	9: 39,289,293	I199N	unknown	Het
Olfr974	T	A	9: 39,942,509	V83E	probably benign	Het
Pbxip1	A	T	3: 89,447,428	D418V	possibly damaging	Het
Pde2a	C	A	7: 101,509,944	R761S	possibly damaging	Het
Phf10	A	T	17: 14,946,313	C432S	probably damaging	Het
Pitpnm2	T	C	5: 124,121,459	D1271G	probably damaging	Het
Plin1	A	T	7: 79,723,444	L259Q	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Pou6f2	T	A	13: 18,239,794	Q132L	unknown	Het
Ppa2	A	T	3: 133,330,438	N118Y	possibly damaging	Het
Prickle2	T	C	6: 92,410,978	E537G	possibly damaging	Het
Prl3d1	A	G	13: 27,098,701	I141V	possibly damaging	Het
Prl8a1	A	T	13: 27,574,189	V179D	probably damaging	Het
Prr14l	A	G	5: 32,827,145	F1669L	probably benign	Het
Prrg4	T	A	2: 104,839,442	E110V	possibly damaging	Het
Rfx5	C	A	3: 94,958,876	H495Q	unknown	Het
Rgl2	C	T	17: 33,933,429	R367W	probably damaging	Het
Rpe65	A	G	3: 159,622,854	Y433C	probably damaging	Het
Rtn4rl1	C	T	11: 75,265,750	S336F	possibly damaging	Het
Scn2a	A	G	2: 65,748,319	D1446G	probably benign	Het
Sdk1	C	A	5: 142,046,176	T1002K	probably benign	Het
Slc9b2	T	C	3: 135,330,661	S409P	probably benign	Het
Sowahc	A	G	10: 59,222,278	T79A	probably benign	Het
Stk35	T	A	2: 129,801,593	C166S	probably benign	Het
Tarbp2	A	G	15: 102,522,487	H225R	probably benign	Het
Tdrd12	T	A	7: 35,489,223	K530*	probably null	Het
Terf2ip	A	G	8: 112,017,986	I312V	probably benign	Het
Tgfb1	T	C	7: 25,692,539		probably null	Het
Thbs2	T	C	17: 14,671,458	D939G	probably damaging	Het
Ube4b	A	T	4: 149,398,610	I67K	probably benign	Het
Ubn1	G	T	16: 5,077,216	V709F	possibly damaging	Het
Ugt2b5	T	C	5: 87,128,399	K339E	possibly damaging	Het
Vax2	T	C	6: 83,737,900	S266P	probably damaging	Het
Vmn2r108	A	G	17: 20,462,776	I722T	probably benign	Het
Vmn2r95	A	G	17: 18,441,315	K441R	probably benign	Het
Wapl	C	A	14: 34,736,691	D903E	probably benign	Het
Wee1	T	A	7: 110,134,794	V442D	probably benign	Het
Zan	T	C	5: 137,434,096	N2313S	unknown	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13491820	unclassified	probably benign
IGL00228:Cubn	APN	2	13456697	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13381849	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13427056	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13278418	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13282919	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13294230	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13467710	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13381927	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13456623	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13278408	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13478093	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13310566	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13465908	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13284041	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13350862	splice site	probably benign
IGL01534:Cubn	APN	2	13465933	nonsense	probably null
IGL01584:Cubn	APN	2	13308661	splice site	probably benign
IGL01595:Cubn	APN	2	13325216	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13306274	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13489936	nonsense	probably null
IGL01972:Cubn	APN	2	13446072	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13287594	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13339846	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13381837	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13427834	splice site	probably null
IGL02491:Cubn	APN	2	13321228	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13325226	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13446032	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13445040	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13294370	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13318312	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13287094	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13355689	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13426967	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13360329	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13478057	splice site	probably null
mellow	UTSW	2	13478078	missense	probably damaging	1.00
PIT4354001:Cubn	UTSW	2	13468852	nonsense	probably null
PIT4495001:Cubn	UTSW	2	13491750	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13306432	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13356709	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13424694	missense	probably benign	0.01
R0254:Cubn	UTSW	2	13440514	missense	possibly damaging	0.84
R0254:Cubn	UTSW	2	13476035	critical splice donor site	probably null
R0360:Cubn	UTSW	2	13310507	splice site	probably benign
R0364:Cubn	UTSW	2	13310507	splice site	probably benign
R0383:Cubn	UTSW	2	13430959	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13469763	missense	possibly damaging	0.77
R0419:Cubn	UTSW	2	13469764	missense	possibly damaging	0.87
R0498:Cubn	UTSW	2	13444267	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13428680	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13360252	splice site	probably null
R0735:Cubn	UTSW	2	13491689	splice site	probably benign
R0780:Cubn	UTSW	2	13456613	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13362328	missense	possibly damaging	0.54
R1118:Cubn	UTSW	2	13336242	missense	possibly damaging	0.78
R1182:Cubn	UTSW	2	13445000	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13360319	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13476120	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13427105	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13287661	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13427967	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13469789	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13489317	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13308561	missense	probably damaging	1.00
R1874:Cubn	UTSW	2	13323002	missense	probably damaging	1.00
R1923:Cubn	UTSW	2	13310526	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13278538	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13340017	splice site	probably null
R2021:Cubn	UTSW	2	13308549	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13444378	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13318242	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13404080	nonsense	probably null
R2369:Cubn	UTSW	2	13491217	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13476150	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13318272	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13278356	splice site	probably null
R2850:Cubn	UTSW	2	13322953	missense	probably damaging	1.00
R2853:Cubn	UTSW	2	13430834	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13358139	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13358162	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13333508	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13331585	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13427914	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13360353	missense	probably benign	0.01
R3813:Cubn	UTSW	2	13294325	missense	probably damaging	1.00
R3845:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13286980	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13326677	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13313999	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13428563	intron	probably benign
R4405:Cubn	UTSW	2	13466030	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13428749	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13313979	splice site	probably null
R4770:Cubn	UTSW	2	13314767	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13287024	missense	possibly damaging	0.94
R4799:Cubn	UTSW	2	13351058	missense	probably damaging	1.00
R4812:Cubn	UTSW	2	13459076	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13325225	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13489910	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13348045	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13478202	nonsense	probably null
R5305:Cubn	UTSW	2	13388939	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13491695	splice site	probably null
R5530:Cubn	UTSW	2	13308523	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13350932	missense	probably benign	0.00
R5737:Cubn	UTSW	2	13388891	missense	probably damaging	1.00
R5886:Cubn	UTSW	2	13320023	splice site	probably benign
R5923:Cubn	UTSW	2	13486078	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13430897	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13308618	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13349876	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13478078	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13280195	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13430995	missense	probably damaging	0.96
R6368:Cubn	UTSW	2	13476123	missense	probably damaging	0.98
R6383:Cubn	UTSW	2	13427835	critical splice donor site	probably null
R6393:Cubn	UTSW	2	13355680	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13294203	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13459002	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13310673	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13430872	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13476064	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13321255	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13445029	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13444253	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13318278	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13348029	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13381837	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13486789	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13306280	missense	probably benign	0.00
R7076:Cubn	UTSW	2	13306281	missense	probably benign	0.10
R7086:Cubn	UTSW	2	13319858	missense	probably damaging	0.98
R7162:Cubn	UTSW	2	13342498	missense	probably damaging	0.96
R7292:Cubn	UTSW	2	13424739	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13340332	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13468771	missense	probably damaging	0.99
R7395:Cubn	UTSW	2	13287064	missense	probably damaging	1.00
R7417:Cubn	UTSW	2	13426967	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13455509	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13348178	missense	probably benign
R7699:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13348178	missense	probably benign
R7700:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7751:Cubn	UTSW	2	13360365	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13280078	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13348150	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13468869	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13424727	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13332355	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13336086	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13479178	missense	probably benign	0.01
R8120:Cubn	UTSW	2	13331660	missense	probably damaging	1.00
R8133:Cubn	UTSW	2	13388848	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13294318	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13349877	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13486802	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13306463	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13340242	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13430847	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13428724	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13325160	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13428756	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13381799	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13314044	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13308520	critical splice donor site	probably null
R8699:Cubn	UTSW	2	13383959	missense	probably damaging	1.00
R8753:Cubn	UTSW	2	13308566	nonsense	probably null
R8874:Cubn	UTSW	2	13360346	missense	possibly damaging	0.63
R9056:Cubn	UTSW	2	13456655	missense	probably damaging	1.00
R9079:Cubn	UTSW	2	13287103	missense	probably benign	0.02
R9143:Cubn	UTSW	2	13332465	splice site	probably benign
R9261:Cubn	UTSW	2	13278451	missense	probably damaging	1.00
R9338:Cubn	UTSW	2	13381892	missense	probably damaging	1.00
R9342:Cubn	UTSW	2	13458956	missense	probably damaging	0.99
R9603:Cubn	UTSW	2	13287699	missense	probably damaging	1.00
R9614:Cubn	UTSW	2	13478134	missense	probably benign	0.00
R9615:Cubn	UTSW	2	13321180	missense	possibly damaging	0.88
R9616:Cubn	UTSW	2	13314718	missense	probably benign	0.04
R9774:Cubn	UTSW	2	13428719	missense	probably benign
X0018:Cubn	UTSW	2	13458986	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13476076	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13342581	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13322962	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13383992	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13294229	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13381825	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAAGCACACTTTTCTTTGCCATCAG -3'
(R):5'- TTTTCCTTACTCCAGAAGGATATCC -3'

Sequencing Primer
(F):5'- ACACTTTTCTTTGCCATCAGTGATC -3'
(R):5'- AGATCCTTCCAGTTGGAG -3'

Posted On

2019-06-26