Incidental Mutation 'R7203:Pbxip1'
ID560751
Institutional Source Beutler Lab
Gene Symbol Pbxip1
Ensembl Gene ENSMUSG00000042613
Gene Namepre B cell leukemia transcription factor interacting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7203 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89436706-89450952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89447428 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 418 (D418V)
Ref Sequence ENSEMBL: ENSMUSP00000040429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038942] [ENSMUST00000130858] [ENSMUST00000145753] [ENSMUST00000146630]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038942
AA Change: D418V

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040429
Gene: ENSMUSG00000042613
AA Change: D418V

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
coiled coil region 270 350 N/A INTRINSIC
coiled coil region 379 405 N/A INTRINSIC
low complexity region 672 691 N/A INTRINSIC
low complexity region 692 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130858
SMART Domains Protein: ENSMUSP00000118496
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 149 159 N/A INTRINSIC
low complexity region 169 184 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145753
SMART Domains Protein: ENSMUSP00000121658
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (108/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the PBX1 homeodomain protein, inhibiting its transcriptional activation potential by preventing its binding to DNA. The encoded protein, which is primarily cytosolic but can shuttle to the nucleus, also can interact with estrogen receptors alpha and beta and promote the proliferation of breast cancer, brain tumors, and lung cancer. Several transcript variants encoding different isoforms have been found for this gene. More variants exist, but their full-length natures have yet to be determined. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,953,333 V184A probably benign Het
4932415D10Rik G A 10: 82,293,414 T1254I probably benign Het
Aars2 A G 17: 45,516,571 Y513C probably damaging Het
Ackr2 G A 9: 121,908,967 C136Y probably damaging Het
Aldh1l1 A G 6: 90,570,800 K414R probably benign Het
Arl9 A G 5: 77,007,271 Y83C possibly damaging Het
Atp10a G T 7: 58,786,473 R337L probably benign Het
Atp6v1g3 A T 1: 138,287,800 Q66L probably damaging Het
Atp7b A T 8: 21,997,335 N1321K probably damaging Het
Axdnd1 A T 1: 156,382,389 M437K probably damaging Het
Bap1 C A 14: 31,254,169 P147Q probably damaging Het
Bicd1 C T 6: 149,512,905 T372I possibly damaging Het
Brix1 T C 15: 10,483,292 probably null Het
Btrc A G 19: 45,513,528 probably null Het
C130050O18Rik A C 5: 139,414,374 I61L probably benign Het
Cfap161 A G 7: 83,776,050 S278P probably damaging Het
Cgnl1 T C 9: 71,724,533 D512G possibly damaging Het
Chat T C 14: 32,419,057 D461G probably damaging Het
Chl1 T A 6: 103,691,674 V456D probably benign Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Cubn T G 2: 13,351,003 H1806P probably benign Het
Dapk1 T A 13: 60,696,335 V56E possibly damaging Het
Dennd4a A G 9: 64,896,474 N1032D probably benign Het
Dlg5 T A 14: 24,138,655 E1756V probably damaging Het
Dnah1 T C 14: 31,274,382 T2666A probably benign Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah6 T A 6: 73,173,545 E745V probably benign Het
Dock8 A T 19: 25,181,563 N1695I probably damaging Het
Esf1 C T 2: 140,164,219 R336Q possibly damaging Het
Fam161a A G 11: 23,021,664 probably null Het
Fam89a T C 8: 124,751,679 E44G possibly damaging Het
Fndc3b A T 3: 27,456,485 D829E probably benign Het
Fxr1 C T 3: 34,046,540 T125I possibly damaging Het
Gfer T C 17: 24,695,862 D69G probably damaging Het
Gm16486 A T 8: 70,716,948 E1229V probably benign Het
Gm2000 A T 1: 156,366,087 I4F probably damaging Het
Gpatch2l T A 12: 86,288,937 S471T probably benign Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gsn A G 2: 35,298,795 I447V probably benign Het
H2al2c C T Y: 2,599,234 L46F possibly damaging Het
Hao2 A C 3: 98,877,282 probably null Het
Ifitm10 T C 7: 142,328,568 E155G probably benign Het
Igkv8-16 C A 6: 70,386,810 W76L probably benign Het
Igsf21 A T 4: 140,107,337 F75I possibly damaging Het
Ints14 T A 9: 64,964,419 M13K probably damaging Het
Ipmk A T 10: 71,363,468 D53V possibly damaging Het
Itga8 A G 2: 12,230,095 F451L possibly damaging Het
Jup A G 11: 100,381,734 F284S probably damaging Het
Kctd5 T C 17: 24,073,235 D65G probably benign Het
Klrc1 A T 6: 129,677,221 S148T probably benign Het
Kmt5b A G 19: 3,814,147 K404E probably damaging Het
Krt9 A C 11: 100,190,791 M304R probably damaging Het
Krtap5-1 A T 7: 142,296,562 S143T unknown Het
Kyat3 A G 3: 142,720,401 N68D probably damaging Het
Kynu A G 2: 43,681,353 D427G probably damaging Het
Leo1 A G 9: 75,445,996 probably null Het
Loxhd1 A G 18: 77,414,196 D1737G probably damaging Het
Lpo C A 11: 87,809,251 L521F possibly damaging Het
Lrrk1 A G 7: 66,270,825 S1477P probably damaging Het
Lrrtm1 C A 6: 77,243,601 L14M probably damaging Het
Ly75 G A 2: 60,323,852 R1084* probably null Het
Mcf2l A G 8: 13,010,456 D764G probably benign Het
Mrgprd A T 7: 145,322,349 D319V probably benign Het
Mut A T 17: 40,938,673 M180L probably benign Het
Myom3 T C 4: 135,795,179 L897P possibly damaging Het
Ncapd2 A T 6: 125,184,328 M247K possibly damaging Het
Nlrp2 T C 7: 5,317,534 D868G probably damaging Het
Npy6r A G 18: 44,275,932 N140S probably damaging Het
Nsmce4a T C 7: 130,539,872 K196E probably benign Het
Nup88 T C 11: 70,945,254 K532R probably benign Het
Olfr424 T A 1: 174,137,114 Y123* probably null Het
Olfr947-ps1 A T 9: 39,289,293 I199N unknown Het
Olfr974 T A 9: 39,942,509 V83E probably benign Het
Pde2a C A 7: 101,509,944 R761S possibly damaging Het
Phf10 A T 17: 14,946,313 C432S probably damaging Het
Pitpnm2 T C 5: 124,121,459 D1271G probably damaging Het
Plin1 A T 7: 79,723,444 L259Q probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pou6f2 T A 13: 18,239,794 Q132L unknown Het
Ppa2 A T 3: 133,330,438 N118Y possibly damaging Het
Prickle2 T C 6: 92,410,978 E537G possibly damaging Het
Prl3d1 A G 13: 27,098,701 I141V possibly damaging Het
Prl8a1 A T 13: 27,574,189 V179D probably damaging Het
Prr14l A G 5: 32,827,145 F1669L probably benign Het
Prrg4 T A 2: 104,839,442 E110V possibly damaging Het
Rfx5 C A 3: 94,958,876 H495Q unknown Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rpe65 A G 3: 159,622,854 Y433C probably damaging Het
Rtn4rl1 C T 11: 75,265,750 S336F possibly damaging Het
Scn2a A G 2: 65,748,319 D1446G probably benign Het
Sdk1 C A 5: 142,046,176 T1002K probably benign Het
Slc9b2 T C 3: 135,330,661 S409P probably benign Het
Sowahc A G 10: 59,222,278 T79A probably benign Het
Stk35 T A 2: 129,801,593 C166S probably benign Het
Tarbp2 A G 15: 102,522,487 H225R probably benign Het
Tdrd12 T A 7: 35,489,223 K530* probably null Het
Terf2ip A G 8: 112,017,986 I312V probably benign Het
Tgfb1 T C 7: 25,692,539 probably null Het
Thbs2 T C 17: 14,671,458 D939G probably damaging Het
Ube4b A T 4: 149,398,610 I67K probably benign Het
Ubn1 G T 16: 5,077,216 V709F possibly damaging Het
Ugt2b5 T C 5: 87,128,399 K339E possibly damaging Het
Vax2 T C 6: 83,737,900 S266P probably damaging Het
Vmn2r108 A G 17: 20,462,776 I722T probably benign Het
Vmn2r95 A G 17: 18,441,315 K441R probably benign Het
Wapl C A 14: 34,736,691 D903E probably benign Het
Wee1 T A 7: 110,134,794 V442D probably benign Het
Zan T C 5: 137,434,096 N2313S unknown Het
Other mutations in Pbxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Pbxip1 APN 3 89443590 splice site probably benign
IGL02612:Pbxip1 APN 3 89443681 missense probably damaging 1.00
IGL02718:Pbxip1 APN 3 89448004 missense probably damaging 1.00
R0538:Pbxip1 UTSW 3 89447619 missense possibly damaging 0.79
R0549:Pbxip1 UTSW 3 89443592 splice site probably benign
R1460:Pbxip1 UTSW 3 89445614 missense probably damaging 1.00
R1931:Pbxip1 UTSW 3 89447677 unclassified probably null
R1966:Pbxip1 UTSW 3 89445488 missense probably damaging 1.00
R2008:Pbxip1 UTSW 3 89448713 missense probably benign 0.20
R3435:Pbxip1 UTSW 3 89447236 missense probably damaging 0.99
R4504:Pbxip1 UTSW 3 89446383 missense possibly damaging 0.48
R4591:Pbxip1 UTSW 3 89446160 missense probably benign 0.33
R5491:Pbxip1 UTSW 3 89443159 missense probably benign 0.09
R6051:Pbxip1 UTSW 3 89443170 missense probably benign 0.08
R6620:Pbxip1 UTSW 3 89447826 missense probably benign 0.12
R7259:Pbxip1 UTSW 3 89445633 missense probably benign
R7604:Pbxip1 UTSW 3 89445595 missense probably benign 0.01
R7687:Pbxip1 UTSW 3 89448199 missense probably damaging 1.00
R7710:Pbxip1 UTSW 3 89448101 missense probably damaging 1.00
X0012:Pbxip1 UTSW 3 89445523 missense possibly damaging 0.91
X0012:Pbxip1 UTSW 3 89446383 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AGGGCTAGAGGCTAACTGTG -3'
(R):5'- AGTTCCCATCTTTCCTAGGGTG -3'

Sequencing Primer
(F):5'- CTAGAGGCTAACTGTGTCCGG -3'
(R):5'- TCGGCTTCCAGTGCTCAG -3'
Posted On2019-06-26