Mutagenetix > Incidental Mutation

Incidental Mutation 'R7203:Ube4b'

560759

Institutional Source

Beutler Lab

Gene Symbol

Ube4b

Ensembl Gene

ENSMUSG00000028960

Gene Name

ubiquitination factor E4B

Synonyms

UFD2a, 4930551I19Rik, Ufd2p, 4933406G05Rik, UFD2, D4Bwg0973e

MMRRC Submission

045281-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7203 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

149328416-149426749 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 149398610 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 67 (I67K)

Ref Sequence

ENSEMBL: ENSMUSP00000099501 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103212] [ENSMUST00000172836] [ENSMUST00000174343]

AlphaFold

Q9ES00

PDB Structure

U-box domain of the E3 Ubiquitin Ligase E4B [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000103212
AA Change: I67K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099501
Gene: ENSMUSG00000028960
AA Change: I67K

Domain	Start	End	E-Value	Type
low complexity region	10	20	N/A	INTRINSIC
low complexity region	21	33	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
low complexity region	76	99	N/A	INTRINSIC
low complexity region	261	278	N/A	INTRINSIC
low complexity region	439	452	N/A	INTRINSIC
Pfam:Ufd2P_core	462	1083	1.3e-199	PFAM
Ubox	1102	1164	3.94e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172836
AA Change: I67K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000134452
Gene: ENSMUSG00000028960
AA Change: I67K

Domain	Start	End	E-Value	Type
low complexity region	10	20	N/A	INTRINSIC
low complexity region	21	33	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
low complexity region	76	99	N/A	INTRINSIC
low complexity region	261	278	N/A	INTRINSIC
low complexity region	439	452	N/A	INTRINSIC
Pfam:Ufd2P_core	462	983	7.4e-143	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174343
AA Change: I67K

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000134556
Gene: ENSMUSG00000028960
AA Change: I67K

Domain	Start	End	E-Value	Type
low complexity region	10	20	N/A	INTRINSIC
low complexity region	21	33	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
low complexity region	76	99	N/A	INTRINSIC
low complexity region	261	278	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (108/108)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes an additional conjugation factor, E4, which is involved in multiubiquitin chain assembly. This gene is also the strongest candidate in the neuroblastoma tumor suppressor genes. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die by midgestation and exhibit cardiac development defects such as hemorrhage and cardiomyocyte apoptosis. Heterozygous mice exhibit axonal dystrophy in the nucleus gracilis, degeneration of Purkinje cells and gait abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544G11Rik	T	C	6: 65,953,333	V184A	probably benign	Het
4932415D10Rik	G	A	10: 82,293,414	T1254I	probably benign	Het
Aars2	A	G	17: 45,516,571	Y513C	probably damaging	Het
Ackr2	G	A	9: 121,908,967	C136Y	probably damaging	Het
Aldh1l1	A	G	6: 90,570,800	K414R	probably benign	Het
Arl9	A	G	5: 77,007,271	Y83C	possibly damaging	Het
Atp10a	G	T	7: 58,786,473	R337L	probably benign	Het
Atp6v1g3	A	T	1: 138,287,800	Q66L	probably damaging	Het
Atp7b	A	T	8: 21,997,335	N1321K	probably damaging	Het
Axdnd1	A	T	1: 156,382,389	M437K	probably damaging	Het
Bap1	C	A	14: 31,254,169	P147Q	probably damaging	Het
Bicd1	C	T	6: 149,512,905	T372I	possibly damaging	Het
Brix1	T	C	15: 10,483,292		probably null	Het
Btrc	A	G	19: 45,513,528		probably null	Het
C130050O18Rik	A	C	5: 139,414,374	I61L	probably benign	Het
Cfap161	A	G	7: 83,776,050	S278P	probably damaging	Het
Cgnl1	T	C	9: 71,724,533	D512G	possibly damaging	Het
Chat	T	C	14: 32,419,057	D461G	probably damaging	Het
Chl1	T	A	6: 103,691,674	V456D	probably benign	Het
Cib1	T	C	7: 80,232,372	T20A	possibly damaging	Het
Cubn	T	G	2: 13,351,003	H1806P	probably benign	Het
Dapk1	T	A	13: 60,696,335	V56E	possibly damaging	Het
Dennd4a	A	G	9: 64,896,474	N1032D	probably benign	Het
Dlg5	T	A	14: 24,138,655	E1756V	probably damaging	Het
Dnah1	T	C	14: 31,274,382	T2666A	probably benign	Het
Dnah11	A	T	12: 118,045,522	I2135N	possibly damaging	Het
Dnah6	T	A	6: 73,173,545	E745V	probably benign	Het
Dock8	A	T	19: 25,181,563	N1695I	probably damaging	Het
Esf1	C	T	2: 140,164,219	R336Q	possibly damaging	Het
Fam161a	A	G	11: 23,021,664		probably null	Het
Fam89a	T	C	8: 124,751,679	E44G	possibly damaging	Het
Fndc3b	A	T	3: 27,456,485	D829E	probably benign	Het
Fxr1	C	T	3: 34,046,540	T125I	possibly damaging	Het
Gfer	T	C	17: 24,695,862	D69G	probably damaging	Het
Gm16486	A	T	8: 70,716,948	E1229V	probably benign	Het
Gm2000	A	T	1: 156,366,087	I4F	probably damaging	Het
Gpatch2l	T	A	12: 86,288,937	S471T	probably benign	Het
Grm7	T	G	6: 111,358,569	I647S	possibly damaging	Het
Gsn	A	G	2: 35,298,795	I447V	probably benign	Het
H2al2c	C	T	Y: 2,599,234	L46F	possibly damaging	Het
Hao2	A	C	3: 98,877,282		probably null	Het
Ifitm10	T	C	7: 142,328,568	E155G	probably benign	Het
Igkv8-16	C	A	6: 70,386,810	W76L	probably benign	Het
Igsf21	A	T	4: 140,107,337	F75I	possibly damaging	Het
Ints14	T	A	9: 64,964,419	M13K	probably damaging	Het
Ipmk	A	T	10: 71,363,468	D53V	possibly damaging	Het
Itga8	A	G	2: 12,230,095	F451L	possibly damaging	Het
Jup	A	G	11: 100,381,734	F284S	probably damaging	Het
Kctd5	T	C	17: 24,073,235	D65G	probably benign	Het
Klrc1	A	T	6: 129,677,221	S148T	probably benign	Het
Kmt5b	A	G	19: 3,814,147	K404E	probably damaging	Het
Krt9	A	C	11: 100,190,791	M304R	probably damaging	Het
Krtap5-1	A	T	7: 142,296,562	S143T	unknown	Het
Kyat3	A	G	3: 142,720,401	N68D	probably damaging	Het
Kynu	A	G	2: 43,681,353	D427G	probably damaging	Het
Leo1	A	G	9: 75,445,996		probably null	Het
Loxhd1	A	G	18: 77,414,196	D1737G	probably damaging	Het
Lpo	C	A	11: 87,809,251	L521F	possibly damaging	Het
Lrrk1	A	G	7: 66,270,825	S1477P	probably damaging	Het
Lrrtm1	C	A	6: 77,243,601	L14M	probably damaging	Het
Ly75	G	A	2: 60,323,852	R1084*	probably null	Het
Mcf2l	A	G	8: 13,010,456	D764G	probably benign	Het
Mrgprd	A	T	7: 145,322,349	D319V	probably benign	Het
Mut	A	T	17: 40,938,673	M180L	probably benign	Het
Myom3	T	C	4: 135,795,179	L897P	possibly damaging	Het
Ncapd2	A	T	6: 125,184,328	M247K	possibly damaging	Het
Nlrp2	T	C	7: 5,317,534	D868G	probably damaging	Het
Npy6r	A	G	18: 44,275,932	N140S	probably damaging	Het
Nsmce4a	T	C	7: 130,539,872	K196E	probably benign	Het
Nup88	T	C	11: 70,945,254	K532R	probably benign	Het
Olfr424	T	A	1: 174,137,114	Y123*	probably null	Het
Olfr947-ps1	A	T	9: 39,289,293	I199N	unknown	Het
Olfr974	T	A	9: 39,942,509	V83E	probably benign	Het
Pbxip1	A	T	3: 89,447,428	D418V	possibly damaging	Het
Pde2a	C	A	7: 101,509,944	R761S	possibly damaging	Het
Phf10	A	T	17: 14,946,313	C432S	probably damaging	Het
Pitpnm2	T	C	5: 124,121,459	D1271G	probably damaging	Het
Plin1	A	T	7: 79,723,444	L259Q	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Pou6f2	T	A	13: 18,239,794	Q132L	unknown	Het
Ppa2	A	T	3: 133,330,438	N118Y	possibly damaging	Het
Prickle2	T	C	6: 92,410,978	E537G	possibly damaging	Het
Prl3d1	A	G	13: 27,098,701	I141V	possibly damaging	Het
Prl8a1	A	T	13: 27,574,189	V179D	probably damaging	Het
Prr14l	A	G	5: 32,827,145	F1669L	probably benign	Het
Prrg4	T	A	2: 104,839,442	E110V	possibly damaging	Het
Rfx5	C	A	3: 94,958,876	H495Q	unknown	Het
Rgl2	C	T	17: 33,933,429	R367W	probably damaging	Het
Rpe65	A	G	3: 159,622,854	Y433C	probably damaging	Het
Rtn4rl1	C	T	11: 75,265,750	S336F	possibly damaging	Het
Scn2a	A	G	2: 65,748,319	D1446G	probably benign	Het
Sdk1	C	A	5: 142,046,176	T1002K	probably benign	Het
Slc9b2	T	C	3: 135,330,661	S409P	probably benign	Het
Sowahc	A	G	10: 59,222,278	T79A	probably benign	Het
Stk35	T	A	2: 129,801,593	C166S	probably benign	Het
Tarbp2	A	G	15: 102,522,487	H225R	probably benign	Het
Tdrd12	T	A	7: 35,489,223	K530*	probably null	Het
Terf2ip	A	G	8: 112,017,986	I312V	probably benign	Het
Tgfb1	T	C	7: 25,692,539		probably null	Het
Thbs2	T	C	17: 14,671,458	D939G	probably damaging	Het
Ubn1	G	T	16: 5,077,216	V709F	possibly damaging	Het
Ugt2b5	T	C	5: 87,128,399	K339E	possibly damaging	Het
Vax2	T	C	6: 83,737,900	S266P	probably damaging	Het
Vmn2r108	A	G	17: 20,462,776	I722T	probably benign	Het
Vmn2r95	A	G	17: 18,441,315	K441R	probably benign	Het
Wapl	C	A	14: 34,736,691	D903E	probably benign	Het
Wee1	T	A	7: 110,134,794	V442D	probably benign	Het
Zan	T	C	5: 137,434,096	N2313S	unknown	Het

Other mutations in Ube4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Ube4b	APN	4	149381366	missense	probably benign	0.29
IGL00820:Ube4b	APN	4	149352921	splice site	probably benign
IGL01093:Ube4b	APN	4	149330269	missense	probably benign	0.01
IGL01154:Ube4b	APN	4	149365470	missense	probably benign	0.28
IGL01612:Ube4b	APN	4	149383818	missense	probably damaging	0.98
IGL01800:Ube4b	APN	4	149331494	missense	probably damaging	1.00
IGL02149:Ube4b	APN	4	149398684	missense	possibly damaging	0.88
IGL02472:Ube4b	APN	4	149387079	critical splice donor site	probably null
IGL02839:Ube4b	APN	4	149368399	missense	probably damaging	0.98
IGL03027:Ube4b	APN	4	149381277	missense	probably damaging	1.00
R0143:Ube4b	UTSW	4	149355457	missense	possibly damaging	0.61
R0164:Ube4b	UTSW	4	149360324	missense	probably damaging	0.98
R0164:Ube4b	UTSW	4	149360324	missense	probably damaging	0.98
R0206:Ube4b	UTSW	4	149398637	missense	probably benign	0.38
R0591:Ube4b	UTSW	4	149357577	intron	probably benign
R1366:Ube4b	UTSW	4	149335149	missense	probably damaging	0.98
R1452:Ube4b	UTSW	4	149371169	missense	probably damaging	1.00
R1513:Ube4b	UTSW	4	149351578	missense	probably benign	0.17
R1668:Ube4b	UTSW	4	149361294	missense	probably benign	0.02
R1874:Ube4b	UTSW	4	149347971	missense	probably damaging	1.00
R2002:Ube4b	UTSW	4	149383797	missense	probably benign	0.16
R2050:Ube4b	UTSW	4	149344612	missense	probably damaging	1.00
R2109:Ube4b	UTSW	4	149372841	missense	probably benign	0.00
R2281:Ube4b	UTSW	4	149344572	missense	probably damaging	1.00
R3547:Ube4b	UTSW	4	149335116	missense	probably damaging	1.00
R3881:Ube4b	UTSW	4	149365404	splice site	probably null
R4378:Ube4b	UTSW	4	149383798	missense	probably damaging	1.00
R4563:Ube4b	UTSW	4	149359165	intron	probably benign
R4674:Ube4b	UTSW	4	149331370	missense	possibly damaging	0.86
R4716:Ube4b	UTSW	4	149344612	missense	probably damaging	1.00
R5026:Ube4b	UTSW	4	149360565	missense	probably damaging	1.00
R5125:Ube4b	UTSW	4	149342992	missense	probably damaging	1.00
R5178:Ube4b	UTSW	4	149342992	missense	probably damaging	1.00
R5182:Ube4b	UTSW	4	149381242	missense	probably null	0.08
R5229:Ube4b	UTSW	4	149387178	missense	probably damaging	1.00
R5303:Ube4b	UTSW	4	149383803	missense	probably damaging	0.98
R5346:Ube4b	UTSW	4	149337424	missense	possibly damaging	0.91
R5780:Ube4b	UTSW	4	149331364	missense	probably benign	0.00
R5813:Ube4b	UTSW	4	149337468	missense	probably damaging	1.00
R5842:Ube4b	UTSW	4	149331430	missense	probably benign	0.01
R5994:Ube4b	UTSW	4	149372932	missense	probably damaging	0.97
R6020:Ube4b	UTSW	4	149368311	missense	probably benign	0.17
R6125:Ube4b	UTSW	4	149398746	missense	probably benign	0.13
R6272:Ube4b	UTSW	4	149387133	missense	probably damaging	1.00
R6333:Ube4b	UTSW	4	149348037	missense	probably damaging	1.00
R6426:Ube4b	UTSW	4	149425996	unclassified	probably benign
R7341:Ube4b	UTSW	4	149343001	missense	probably damaging	1.00
R7672:Ube4b	UTSW	4	149387204	missense	probably benign	0.10
R7713:Ube4b	UTSW	4	149398781	missense	possibly damaging	0.53
R8175:Ube4b	UTSW	4	149351516	missense	probably benign	0.13
R9042:Ube4b	UTSW	4	149360376	missense	probably benign
R9173:Ube4b	UTSW	4	149331476	missense	probably damaging	0.96
R9462:Ube4b	UTSW	4	149360291	missense	probably damaging	0.97
R9577:Ube4b	UTSW	4	149383774	missense	possibly damaging	0.51
Z1088:Ube4b	UTSW	4	149335125	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AGGAGCAACTCAGTCTTCGC -3'
(R):5'- TCTGTAGATTCGACGGAGGC -3'

Sequencing Primer
(F):5'- TCTTCGCCAGACCTGAGC -3'
(R):5'- ATTCGACGGAGGCGCCTG -3'

Posted On

2019-06-26