Incidental Mutation 'R7203:Sdk1'
ID560766
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Namesidekick cell adhesion molecule 1
Synonyms6720466O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7203 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location141241490-142215586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 142046176 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1002 (T1002K)
Ref Sequence ENSEMBL: ENSMUSP00000082928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
Predicted Effect probably benign
Transcript: ENSMUST00000074546
AA Change: T742K

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: T742K

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085774
AA Change: T1002K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: T1002K

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (108/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,953,333 V184A probably benign Het
4932415D10Rik G A 10: 82,293,414 T1254I probably benign Het
Aars2 A G 17: 45,516,571 Y513C probably damaging Het
Ackr2 G A 9: 121,908,967 C136Y probably damaging Het
Aldh1l1 A G 6: 90,570,800 K414R probably benign Het
Arl9 A G 5: 77,007,271 Y83C possibly damaging Het
Atp10a G T 7: 58,786,473 R337L probably benign Het
Atp6v1g3 A T 1: 138,287,800 Q66L probably damaging Het
Atp7b A T 8: 21,997,335 N1321K probably damaging Het
Axdnd1 A T 1: 156,382,389 M437K probably damaging Het
Bap1 C A 14: 31,254,169 P147Q probably damaging Het
Bicd1 C T 6: 149,512,905 T372I possibly damaging Het
Brix1 T C 15: 10,483,292 probably null Het
Btrc A G 19: 45,513,528 probably null Het
C130050O18Rik A C 5: 139,414,374 I61L probably benign Het
Cfap161 A G 7: 83,776,050 S278P probably damaging Het
Cgnl1 T C 9: 71,724,533 D512G possibly damaging Het
Chat T C 14: 32,419,057 D461G probably damaging Het
Chl1 T A 6: 103,691,674 V456D probably benign Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Cubn T G 2: 13,351,003 H1806P probably benign Het
Dapk1 T A 13: 60,696,335 V56E possibly damaging Het
Dennd4a A G 9: 64,896,474 N1032D probably benign Het
Dlg5 T A 14: 24,138,655 E1756V probably damaging Het
Dnah1 T C 14: 31,274,382 T2666A probably benign Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah6 T A 6: 73,173,545 E745V probably benign Het
Dock8 A T 19: 25,181,563 N1695I probably damaging Het
Esf1 C T 2: 140,164,219 R336Q possibly damaging Het
Fam161a A G 11: 23,021,664 probably null Het
Fam89a T C 8: 124,751,679 E44G possibly damaging Het
Fndc3b A T 3: 27,456,485 D829E probably benign Het
Fxr1 C T 3: 34,046,540 T125I possibly damaging Het
Gfer T C 17: 24,695,862 D69G probably damaging Het
Gm16486 A T 8: 70,716,948 E1229V probably benign Het
Gm2000 A T 1: 156,366,087 I4F probably damaging Het
Gpatch2l T A 12: 86,288,937 S471T probably benign Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gsn A G 2: 35,298,795 I447V probably benign Het
H2al2c C T Y: 2,599,234 L46F possibly damaging Het
Hao2 A C 3: 98,877,282 probably null Het
Ifitm10 T C 7: 142,328,568 E155G probably benign Het
Igkv8-16 C A 6: 70,386,810 W76L probably benign Het
Igsf21 A T 4: 140,107,337 F75I possibly damaging Het
Ints14 T A 9: 64,964,419 M13K probably damaging Het
Ipmk A T 10: 71,363,468 D53V possibly damaging Het
Itga8 A G 2: 12,230,095 F451L possibly damaging Het
Jup A G 11: 100,381,734 F284S probably damaging Het
Kctd5 T C 17: 24,073,235 D65G probably benign Het
Klrc1 A T 6: 129,677,221 S148T probably benign Het
Kmt5b A G 19: 3,814,147 K404E probably damaging Het
Krt9 A C 11: 100,190,791 M304R probably damaging Het
Krtap5-1 A T 7: 142,296,562 S143T unknown Het
Kyat3 A G 3: 142,720,401 N68D probably damaging Het
Kynu A G 2: 43,681,353 D427G probably damaging Het
Leo1 A G 9: 75,445,996 probably null Het
Loxhd1 A G 18: 77,414,196 D1737G probably damaging Het
Lpo C A 11: 87,809,251 L521F possibly damaging Het
Lrrk1 A G 7: 66,270,825 S1477P probably damaging Het
Lrrtm1 C A 6: 77,243,601 L14M probably damaging Het
Ly75 G A 2: 60,323,852 R1084* probably null Het
Mcf2l A G 8: 13,010,456 D764G probably benign Het
Mrgprd A T 7: 145,322,349 D319V probably benign Het
Mut A T 17: 40,938,673 M180L probably benign Het
Myom3 T C 4: 135,795,179 L897P possibly damaging Het
Ncapd2 A T 6: 125,184,328 M247K possibly damaging Het
Nlrp2 T C 7: 5,317,534 D868G probably damaging Het
Npy6r A G 18: 44,275,932 N140S probably damaging Het
Nsmce4a T C 7: 130,539,872 K196E probably benign Het
Nup88 T C 11: 70,945,254 K532R probably benign Het
Olfr424 T A 1: 174,137,114 Y123* probably null Het
Olfr947-ps1 A T 9: 39,289,293 I199N unknown Het
Olfr974 T A 9: 39,942,509 V83E probably benign Het
Pbxip1 A T 3: 89,447,428 D418V possibly damaging Het
Pde2a C A 7: 101,509,944 R761S possibly damaging Het
Phf10 A T 17: 14,946,313 C432S probably damaging Het
Pitpnm2 T C 5: 124,121,459 D1271G probably damaging Het
Plin1 A T 7: 79,723,444 L259Q probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pou6f2 T A 13: 18,239,794 Q132L unknown Het
Ppa2 A T 3: 133,330,438 N118Y possibly damaging Het
Prickle2 T C 6: 92,410,978 E537G possibly damaging Het
Prl3d1 A G 13: 27,098,701 I141V possibly damaging Het
Prl8a1 A T 13: 27,574,189 V179D probably damaging Het
Prr14l A G 5: 32,827,145 F1669L probably benign Het
Prrg4 T A 2: 104,839,442 E110V possibly damaging Het
Rfx5 C A 3: 94,958,876 H495Q unknown Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rpe65 A G 3: 159,622,854 Y433C probably damaging Het
Rtn4rl1 C T 11: 75,265,750 S336F possibly damaging Het
Scn2a A G 2: 65,748,319 D1446G probably benign Het
Slc9b2 T C 3: 135,330,661 S409P probably benign Het
Sowahc A G 10: 59,222,278 T79A probably benign Het
Stk35 T A 2: 129,801,593 C166S probably benign Het
Tarbp2 A G 15: 102,522,487 H225R probably benign Het
Tdrd12 T A 7: 35,489,223 K530* probably null Het
Terf2ip A G 8: 112,017,986 I312V probably benign Het
Tgfb1 T C 7: 25,692,539 probably null Het
Thbs2 T C 17: 14,671,458 D939G probably damaging Het
Ube4b A T 4: 149,398,610 I67K probably benign Het
Ubn1 G T 16: 5,077,216 V709F possibly damaging Het
Ugt2b5 T C 5: 87,128,399 K339E possibly damaging Het
Vax2 T C 6: 83,737,900 S266P probably damaging Het
Vmn2r108 A G 17: 20,462,776 I722T probably benign Het
Vmn2r95 A G 17: 18,441,315 K441R probably benign Het
Wapl C A 14: 34,736,691 D903E probably benign Het
Wee1 T A 7: 110,134,794 V442D probably benign Het
Zan T C 5: 137,434,096 N2313S unknown Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0149:Sdk1 UTSW 5 141857054 intron probably benign
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142034537 missense probably benign 0.00
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1956:Sdk1 UTSW 5 142094581 missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141936049 missense probably benign
R3916:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141959238 missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4825:Sdk1 UTSW 5 141582294 missense probably benign 0.11
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142185265 missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5593:Sdk1 UTSW 5 141956124 missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6164:Sdk1 UTSW 5 142132069 missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142034426 missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 intron probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTACAGAACTCCTTGTGGTAGG -3'
(R):5'- AAGTGTGGGTGCCAAGATCC -3'

Sequencing Primer
(F):5'- CTCCTTGTGGTAGGAACAGGACAC -3'
(R):5'- GTGCCAAGATCCACTGACCTG -3'
Posted On2019-06-26