Incidental Mutation 'R7203:Dnah6'
ID560769
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Namedynein, axonemal, heavy chain 6
SynonymsA730004I20Rik, Dnahc6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7203 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location73017606-73221651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73173545 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 745 (E745V)
Ref Sequence ENSEMBL: ENSMUSP00000068758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
Predicted Effect probably benign
Transcript: ENSMUST00000064948
AA Change: E745V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: E745V

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114040
AA Change: E745V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: E745V

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204053
AA Change: E745V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: E745V

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (108/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,953,333 V184A probably benign Het
4932415D10Rik G A 10: 82,293,414 T1254I probably benign Het
Aars2 A G 17: 45,516,571 Y513C probably damaging Het
Ackr2 G A 9: 121,908,967 C136Y probably damaging Het
Aldh1l1 A G 6: 90,570,800 K414R probably benign Het
Arl9 A G 5: 77,007,271 Y83C possibly damaging Het
Atp10a G T 7: 58,786,473 R337L probably benign Het
Atp6v1g3 A T 1: 138,287,800 Q66L probably damaging Het
Atp7b A T 8: 21,997,335 N1321K probably damaging Het
Axdnd1 A T 1: 156,382,389 M437K probably damaging Het
Bap1 C A 14: 31,254,169 P147Q probably damaging Het
Bicd1 C T 6: 149,512,905 T372I possibly damaging Het
Brix1 T C 15: 10,483,292 probably null Het
Btrc A G 19: 45,513,528 probably null Het
C130050O18Rik A C 5: 139,414,374 I61L probably benign Het
Cfap161 A G 7: 83,776,050 S278P probably damaging Het
Cgnl1 T C 9: 71,724,533 D512G possibly damaging Het
Chat T C 14: 32,419,057 D461G probably damaging Het
Chl1 T A 6: 103,691,674 V456D probably benign Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Cubn T G 2: 13,351,003 H1806P probably benign Het
Dapk1 T A 13: 60,696,335 V56E possibly damaging Het
Dennd4a A G 9: 64,896,474 N1032D probably benign Het
Dlg5 T A 14: 24,138,655 E1756V probably damaging Het
Dnah1 T C 14: 31,274,382 T2666A probably benign Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dock8 A T 19: 25,181,563 N1695I probably damaging Het
Esf1 C T 2: 140,164,219 R336Q possibly damaging Het
Fam161a A G 11: 23,021,664 probably null Het
Fam89a T C 8: 124,751,679 E44G possibly damaging Het
Fndc3b A T 3: 27,456,485 D829E probably benign Het
Fxr1 C T 3: 34,046,540 T125I possibly damaging Het
Gfer T C 17: 24,695,862 D69G probably damaging Het
Gm16486 A T 8: 70,716,948 E1229V probably benign Het
Gm2000 A T 1: 156,366,087 I4F probably damaging Het
Gpatch2l T A 12: 86,288,937 S471T probably benign Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gsn A G 2: 35,298,795 I447V probably benign Het
H2al2c C T Y: 2,599,234 L46F possibly damaging Het
Hao2 A C 3: 98,877,282 probably null Het
Ifitm10 T C 7: 142,328,568 E155G probably benign Het
Igkv8-16 C A 6: 70,386,810 W76L probably benign Het
Igsf21 A T 4: 140,107,337 F75I possibly damaging Het
Ints14 T A 9: 64,964,419 M13K probably damaging Het
Ipmk A T 10: 71,363,468 D53V possibly damaging Het
Itga8 A G 2: 12,230,095 F451L possibly damaging Het
Jup A G 11: 100,381,734 F284S probably damaging Het
Kctd5 T C 17: 24,073,235 D65G probably benign Het
Klrc1 A T 6: 129,677,221 S148T probably benign Het
Kmt5b A G 19: 3,814,147 K404E probably damaging Het
Krt9 A C 11: 100,190,791 M304R probably damaging Het
Krtap5-1 A T 7: 142,296,562 S143T unknown Het
Kyat3 A G 3: 142,720,401 N68D probably damaging Het
Kynu A G 2: 43,681,353 D427G probably damaging Het
Leo1 A G 9: 75,445,996 probably null Het
Loxhd1 A G 18: 77,414,196 D1737G probably damaging Het
Lpo C A 11: 87,809,251 L521F possibly damaging Het
Lrrk1 A G 7: 66,270,825 S1477P probably damaging Het
Lrrtm1 C A 6: 77,243,601 L14M probably damaging Het
Ly75 G A 2: 60,323,852 R1084* probably null Het
Mcf2l A G 8: 13,010,456 D764G probably benign Het
Mrgprd A T 7: 145,322,349 D319V probably benign Het
Mut A T 17: 40,938,673 M180L probably benign Het
Myom3 T C 4: 135,795,179 L897P possibly damaging Het
Ncapd2 A T 6: 125,184,328 M247K possibly damaging Het
Nlrp2 T C 7: 5,317,534 D868G probably damaging Het
Npy6r A G 18: 44,275,932 N140S probably damaging Het
Nsmce4a T C 7: 130,539,872 K196E probably benign Het
Nup88 T C 11: 70,945,254 K532R probably benign Het
Olfr424 T A 1: 174,137,114 Y123* probably null Het
Olfr947-ps1 A T 9: 39,289,293 I199N unknown Het
Olfr974 T A 9: 39,942,509 V83E probably benign Het
Pbxip1 A T 3: 89,447,428 D418V possibly damaging Het
Pde2a C A 7: 101,509,944 R761S possibly damaging Het
Phf10 A T 17: 14,946,313 C432S probably damaging Het
Pitpnm2 T C 5: 124,121,459 D1271G probably damaging Het
Plin1 A T 7: 79,723,444 L259Q probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pou6f2 T A 13: 18,239,794 Q132L unknown Het
Ppa2 A T 3: 133,330,438 N118Y possibly damaging Het
Prickle2 T C 6: 92,410,978 E537G possibly damaging Het
Prl3d1 A G 13: 27,098,701 I141V possibly damaging Het
Prl8a1 A T 13: 27,574,189 V179D probably damaging Het
Prr14l A G 5: 32,827,145 F1669L probably benign Het
Prrg4 T A 2: 104,839,442 E110V possibly damaging Het
Rfx5 C A 3: 94,958,876 H495Q unknown Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rpe65 A G 3: 159,622,854 Y433C probably damaging Het
Rtn4rl1 C T 11: 75,265,750 S336F possibly damaging Het
Scn2a A G 2: 65,748,319 D1446G probably benign Het
Sdk1 C A 5: 142,046,176 T1002K probably benign Het
Slc9b2 T C 3: 135,330,661 S409P probably benign Het
Sowahc A G 10: 59,222,278 T79A probably benign Het
Stk35 T A 2: 129,801,593 C166S probably benign Het
Tarbp2 A G 15: 102,522,487 H225R probably benign Het
Tdrd12 T A 7: 35,489,223 K530* probably null Het
Terf2ip A G 8: 112,017,986 I312V probably benign Het
Tgfb1 T C 7: 25,692,539 probably null Het
Thbs2 T C 17: 14,671,458 D939G probably damaging Het
Ube4b A T 4: 149,398,610 I67K probably benign Het
Ubn1 G T 16: 5,077,216 V709F possibly damaging Het
Ugt2b5 T C 5: 87,128,399 K339E possibly damaging Het
Vax2 T C 6: 83,737,900 S266P probably damaging Het
Vmn2r108 A G 17: 20,462,776 I722T probably benign Het
Vmn2r95 A G 17: 18,441,315 K441R probably benign Het
Wapl C A 14: 34,736,691 D903E probably benign Het
Wee1 T A 7: 110,134,794 V442D probably benign Het
Zan T C 5: 137,434,096 N2313S unknown Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73195737 missense probably benign 0.00
IGL00488:Dnah6 APN 6 73086207 missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73195761 missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73212434 critical splice donor site probably null
IGL00756:Dnah6 APN 6 73123771 missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73156350 missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73033526 splice site probably benign
IGL00972:Dnah6 APN 6 73083157 splice site probably benign
IGL00975:Dnah6 APN 6 73173390 missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73074781 splice site probably benign
IGL01307:Dnah6 APN 6 73065725 missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73173456 missense probably benign 0.01
IGL01362:Dnah6 APN 6 73092178 missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73074748 missense probably benign 0.10
IGL01559:Dnah6 APN 6 73024252 critical splice donor site probably null
IGL01622:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73075802 missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73076660 nonsense probably null
IGL01736:Dnah6 APN 6 73188377 missense probably benign 0.06
IGL01825:Dnah6 APN 6 73065776 missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73135801 missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73032569 missense probably benign 0.04
IGL01935:Dnah6 APN 6 73060143 missense probably benign
IGL02126:Dnah6 APN 6 73103166 missense probably benign 0.01
IGL02191:Dnah6 APN 6 73017797 missense probably benign 0.00
IGL02293:Dnah6 APN 6 73133650 splice site probably benign
IGL02316:Dnah6 APN 6 73168911 missense probably benign 0.19
IGL02339:Dnah6 APN 6 73101898 missense probably benign 0.00
IGL02380:Dnah6 APN 6 73076640 missense probably benign 0.12
IGL02458:Dnah6 APN 6 73027448 missense probably benign 0.43
IGL02499:Dnah6 APN 6 73021227 missense probably benign 0.12
IGL02652:Dnah6 APN 6 73095104 missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73121823 missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73208599 missense probably benign 0.03
IGL02875:Dnah6 APN 6 73138715 missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73032587 missense probably benign 0.01
IGL02989:Dnah6 APN 6 73069420 missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73149140 missense probably benign 0.19
IGL03135:Dnah6 APN 6 73145004 missense probably benign 0.00
IGL03145:Dnah6 APN 6 73041054 missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73144700 missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73053647 splice site probably benign
IGL03286:Dnah6 APN 6 73083085 missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73075850 missense probably benign 0.15
P0025:Dnah6 UTSW 6 73163504 missense probably benign 0.00
PIT4305001:Dnah6 UTSW 6 73065755 missense probably benign 0.03
PIT4466001:Dnah6 UTSW 6 73208641 missense probably benign 0.00
PIT4480001:Dnah6 UTSW 6 73101880 missense probably benign 0.00
PIT4515001:Dnah6 UTSW 6 73114582 missense probably damaging 1.00
PIT4651001:Dnah6 UTSW 6 73060260 missense probably benign 0.02
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73038734 splice site probably benign
R0164:Dnah6 UTSW 6 73188535 splice site probably benign
R0165:Dnah6 UTSW 6 73021323 missense probably benign 0.01
R0183:Dnah6 UTSW 6 73082923 missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73069420 missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73159115 missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73173558 missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73069399 splice site probably benign
R0345:Dnah6 UTSW 6 73021257 missense probably benign 0.12
R0357:Dnah6 UTSW 6 73188359 missense probably benign
R0362:Dnah6 UTSW 6 73208609 missense probably benign 0.06
R0377:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73083124 missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73044774 missense probably benign 0.15
R0639:Dnah6 UTSW 6 73022412 missense probably benign 0.02
R0673:Dnah6 UTSW 6 73123811 missense probably benign 0.01
R0690:Dnah6 UTSW 6 73129474 missense probably benign 0.01
R0708:Dnah6 UTSW 6 73212622 missense probably benign 0.05
R0711:Dnah6 UTSW 6 73087602 missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73035293 missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73124757 missense probably benign 0.00
R0972:Dnah6 UTSW 6 73159193 missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73144965 missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73159135 missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73124709 missense probably benign 0.22
R1301:Dnah6 UTSW 6 73208545 critical splice donor site probably null
R1341:Dnah6 UTSW 6 73191619 missense probably benign 0.09
R1509:Dnah6 UTSW 6 73027442 missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73049048 missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73151553 missense probably benign
R1557:Dnah6 UTSW 6 73049131 nonsense probably null
R1591:Dnah6 UTSW 6 73076600 missense probably benign 0.01
R1602:Dnah6 UTSW 6 73067469 missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73144963 missense probably benign 0.09
R1616:Dnah6 UTSW 6 73100112 missense probably benign 0.10
R1643:Dnah6 UTSW 6 73044752 missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73155296 missense probably benign 0.18
R1655:Dnah6 UTSW 6 73205732 missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1665:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1675:Dnah6 UTSW 6 73129540 missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73044761 missense probably damaging 0.98
R1757:Dnah6 UTSW 6 73160982 missense probably damaging 1.00
R1794:Dnah6 UTSW 6 73024958 missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73181797 missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73100088 missense probably benign 0.00
R1897:Dnah6 UTSW 6 73181762 missense probably benign 0.30
R1951:Dnah6 UTSW 6 73084721 nonsense probably null
R1978:Dnah6 UTSW 6 73121970 missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73095044 missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73092192 missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73067466 missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73173419 missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73027422 missense probably benign
R2041:Dnah6 UTSW 6 73073439 missense probably damaging 1.00
R2068:Dnah6 UTSW 6 73021182 missense probably benign 0.23
R2114:Dnah6 UTSW 6 73144035 missense probably damaging 1.00
R2152:Dnah6 UTSW 6 73049166 missense probably benign 0.32
R2163:Dnah6 UTSW 6 73089746 intron probably null
R2193:Dnah6 UTSW 6 73138640 missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73100085 missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73113581 missense probably benign 0.15
R2292:Dnah6 UTSW 6 73021109 missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73156421 missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73091967 intron probably null
R2436:Dnah6 UTSW 6 73149173 missense probably benign 0.05
R2847:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R2848:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R3033:Dnah6 UTSW 6 73173350 missense probably benign 0.03
R3429:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73032633 missense probably benign 0.21
R3811:Dnah6 UTSW 6 73191498 missense probably benign 0.00
R3852:Dnah6 UTSW 6 73127927 missense possibly damaging 0.82
R3975:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73089592 nonsense probably null
R4246:Dnah6 UTSW 6 73129448 missense probably benign 0.00
R4367:Dnah6 UTSW 6 73149484 missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73118026 missense probably benign 0.01
R4405:Dnah6 UTSW 6 73129291 missense probably benign 0.00
R4420:Dnah6 UTSW 6 73191479 missense probably benign
R4486:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73178416 missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73192405 missense probably benign
R4573:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73152712 missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73129660 missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73070597 missense probably benign
R4653:Dnah6 UTSW 6 73073457 missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73037688 missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73192422 missense probably benign 0.04
R4712:Dnah6 UTSW 6 73025012 critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73129530 missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73095074 missense probably benign 0.11
R4792:Dnah6 UTSW 6 73089668 missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4817:Dnah6 UTSW 6 73022424 missense probably benign 0.02
R4830:Dnah6 UTSW 6 73044762 missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73121788 missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73192676 intron probably benign
R4948:Dnah6 UTSW 6 73053689 missense probably benign 0.00
R4953:Dnah6 UTSW 6 73188383 missense probably benign 0.19
R5000:Dnah6 UTSW 6 73144815 missense probably benign 0.26
R5036:Dnah6 UTSW 6 73044691 missense probably benign
R5044:Dnah6 UTSW 6 73037622 missense probably benign 0.41
R5143:Dnah6 UTSW 6 73181761 missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73195634 missense probably benign
R5186:Dnah6 UTSW 6 73067427 missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73195732 missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73113488 missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73127861 critical splice donor site probably null
R5330:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73212620 missense probably benign
R5343:Dnah6 UTSW 6 73212616 missense probably benign
R5375:Dnah6 UTSW 6 73123855 missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73037615 missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73060138 missense probably benign 0.00
R5455:Dnah6 UTSW 6 73075734 missense probably benign 0.00
R5458:Dnah6 UTSW 6 73086185 missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73092157 missense probably benign 0.04
R5484:Dnah6 UTSW 6 73092116 missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73190419 missense probably null 0.00
R5527:Dnah6 UTSW 6 73159229 missense probably benign
R5541:Dnah6 UTSW 6 73192988 missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73151689 missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73149525 missense probably damaging 1.00
R5689:Dnah6 UTSW 6 73021227 missense probably benign 0.12
R5966:Dnah6 UTSW 6 73060279 missense probably benign 0.00
R5980:Dnah6 UTSW 6 73181722 missense probably benign 0.01
R6049:Dnah6 UTSW 6 73086166 missense probably benign 0.38
R6092:Dnah6 UTSW 6 73114697 missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73188494 missense probably benign 0.16
R6279:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73086217 missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73191605 missense probably benign 0.02
R6394:Dnah6 UTSW 6 73155418 nonsense probably null
R6470:Dnah6 UTSW 6 73074586 missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73074704 missense probably benign 0.05
R6545:Dnah6 UTSW 6 73044732 missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73173533 missense probably benign 0.02
R6609:Dnah6 UTSW 6 73053695 missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73035280 splice site probably null
R6640:Dnah6 UTSW 6 73024293 missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73138760 missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73037549 missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73133608 missense probably benign 0.29
R6845:Dnah6 UTSW 6 73133542 missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73212522 missense probably benign 0.00
R6918:Dnah6 UTSW 6 73181755 nonsense probably null
R6929:Dnah6 UTSW 6 73044773 missense probably damaging 0.96
R6981:Dnah6 UTSW 6 73021178 missense probably benign 0.00
R7065:Dnah6 UTSW 6 73087562 missense possibly damaging 0.87
R7139:Dnah6 UTSW 6 73135680 missense probably damaging 1.00
R7169:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R7202:Dnah6 UTSW 6 73181705 critical splice donor site probably null
R7315:Dnah6 UTSW 6 73084760 missense probably damaging 1.00
R7329:Dnah6 UTSW 6 73144722 nonsense probably null
R7387:Dnah6 UTSW 6 73212612 nonsense probably null
R7388:Dnah6 UTSW 6 73192317 missense possibly damaging 0.47
R7454:Dnah6 UTSW 6 73212492 missense probably damaging 1.00
R7520:Dnah6 UTSW 6 73127904 missense probably benign 0.04
R7524:Dnah6 UTSW 6 73118099 missense probably damaging 1.00
R7548:Dnah6 UTSW 6 73027440 missense probably damaging 1.00
R7570:Dnah6 UTSW 6 73149430 missense probably benign 0.01
R7604:Dnah6 UTSW 6 73092168 missense probably damaging 1.00
R7615:Dnah6 UTSW 6 73095206 missense possibly damaging 0.85
R7622:Dnah6 UTSW 6 73124759 missense possibly damaging 0.94
W0251:Dnah6 UTSW 6 73178518 missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73037673 missense probably damaging 1.00
X0025:Dnah6 UTSW 6 73191500 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTGAGATCTTCAAGGTCCCG -3'
(R):5'- TATCCAGTTACCTGTATTGTAGCG -3'

Sequencing Primer
(F):5'- TCCCGACCCAAGTGCAG -3'
(R):5'- CGATGTTTGTATTTATCACGTGACC -3'
Posted On2019-06-26