Mutagenetix > Incidental Mutation

Incidental Mutation 'R7203:Grm7'

560775

Institutional Source

Beutler Lab

Gene Symbol

Grm7

Ensembl Gene

ENSMUSG00000056755

Gene Name

glutamate receptor, metabotropic 7

Synonyms

Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik

MMRRC Submission

045281-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7203 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110645581-111567230 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 111358569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 647 (I647S)

Ref Sequence

ENSEMBL: ENSMUSP00000133957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]

AlphaFold

Q68ED2

Predicted Effect

probably damaging
Transcript: ENSMUST00000071076
AA Change: I647S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: I647S

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	3e-108	PFAM
Pfam:Peripla_BP_6	144	371	3e-11	PFAM
Pfam:NCD3G	519	569	1.2e-13	PFAM
Pfam:7tm_3	602	847	5.1e-59	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172951
AA Change: I647S

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: I647S

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	1.7e-103	PFAM
Pfam:Peripla_BP_6	144	487	1e-12	PFAM
Pfam:NCD3G	519	569	1.2e-17	PFAM
Pfam:7tm_3	600	848	1.4e-87	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174018

SMART Domains

Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	176	4.9e-20	PFAM

Meta Mutation Damage Score

0.8675

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (108/108)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544G11Rik	T	C	6: 65,953,333	V184A	probably benign	Het
4932415D10Rik	G	A	10: 82,293,414	T1254I	probably benign	Het
Aars2	A	G	17: 45,516,571	Y513C	probably damaging	Het
Ackr2	G	A	9: 121,908,967	C136Y	probably damaging	Het
Aldh1l1	A	G	6: 90,570,800	K414R	probably benign	Het
Arl9	A	G	5: 77,007,271	Y83C	possibly damaging	Het
Atp10a	G	T	7: 58,786,473	R337L	probably benign	Het
Atp6v1g3	A	T	1: 138,287,800	Q66L	probably damaging	Het
Atp7b	A	T	8: 21,997,335	N1321K	probably damaging	Het
Axdnd1	A	T	1: 156,382,389	M437K	probably damaging	Het
Bap1	C	A	14: 31,254,169	P147Q	probably damaging	Het
Bicd1	C	T	6: 149,512,905	T372I	possibly damaging	Het
Brix1	T	C	15: 10,483,292		probably null	Het
Btrc	A	G	19: 45,513,528		probably null	Het
C130050O18Rik	A	C	5: 139,414,374	I61L	probably benign	Het
Cfap161	A	G	7: 83,776,050	S278P	probably damaging	Het
Cgnl1	T	C	9: 71,724,533	D512G	possibly damaging	Het
Chat	T	C	14: 32,419,057	D461G	probably damaging	Het
Chl1	T	A	6: 103,691,674	V456D	probably benign	Het
Cib1	T	C	7: 80,232,372	T20A	possibly damaging	Het
Cubn	T	G	2: 13,351,003	H1806P	probably benign	Het
Dapk1	T	A	13: 60,696,335	V56E	possibly damaging	Het
Dennd4a	A	G	9: 64,896,474	N1032D	probably benign	Het
Dlg5	T	A	14: 24,138,655	E1756V	probably damaging	Het
Dnah1	T	C	14: 31,274,382	T2666A	probably benign	Het
Dnah11	A	T	12: 118,045,522	I2135N	possibly damaging	Het
Dnah6	T	A	6: 73,173,545	E745V	probably benign	Het
Dock8	A	T	19: 25,181,563	N1695I	probably damaging	Het
Esf1	C	T	2: 140,164,219	R336Q	possibly damaging	Het
Fam161a	A	G	11: 23,021,664		probably null	Het
Fam89a	T	C	8: 124,751,679	E44G	possibly damaging	Het
Fndc3b	A	T	3: 27,456,485	D829E	probably benign	Het
Fxr1	C	T	3: 34,046,540	T125I	possibly damaging	Het
Gfer	T	C	17: 24,695,862	D69G	probably damaging	Het
Gm16486	A	T	8: 70,716,948	E1229V	probably benign	Het
Gm2000	A	T	1: 156,366,087	I4F	probably damaging	Het
Gpatch2l	T	A	12: 86,288,937	S471T	probably benign	Het
Gsn	A	G	2: 35,298,795	I447V	probably benign	Het
H2al2c	C	T	Y: 2,599,234	L46F	possibly damaging	Het
Hao2	A	C	3: 98,877,282		probably null	Het
Ifitm10	T	C	7: 142,328,568	E155G	probably benign	Het
Igkv8-16	C	A	6: 70,386,810	W76L	probably benign	Het
Igsf21	A	T	4: 140,107,337	F75I	possibly damaging	Het
Ints14	T	A	9: 64,964,419	M13K	probably damaging	Het
Ipmk	A	T	10: 71,363,468	D53V	possibly damaging	Het
Itga8	A	G	2: 12,230,095	F451L	possibly damaging	Het
Jup	A	G	11: 100,381,734	F284S	probably damaging	Het
Kctd5	T	C	17: 24,073,235	D65G	probably benign	Het
Klrc1	A	T	6: 129,677,221	S148T	probably benign	Het
Kmt5b	A	G	19: 3,814,147	K404E	probably damaging	Het
Krt9	A	C	11: 100,190,791	M304R	probably damaging	Het
Krtap5-1	A	T	7: 142,296,562	S143T	unknown	Het
Kyat3	A	G	3: 142,720,401	N68D	probably damaging	Het
Kynu	A	G	2: 43,681,353	D427G	probably damaging	Het
Leo1	A	G	9: 75,445,996		probably null	Het
Loxhd1	A	G	18: 77,414,196	D1737G	probably damaging	Het
Lpo	C	A	11: 87,809,251	L521F	possibly damaging	Het
Lrrk1	A	G	7: 66,270,825	S1477P	probably damaging	Het
Lrrtm1	C	A	6: 77,243,601	L14M	probably damaging	Het
Ly75	G	A	2: 60,323,852	R1084*	probably null	Het
Mcf2l	A	G	8: 13,010,456	D764G	probably benign	Het
Mrgprd	A	T	7: 145,322,349	D319V	probably benign	Het
Mut	A	T	17: 40,938,673	M180L	probably benign	Het
Myom3	T	C	4: 135,795,179	L897P	possibly damaging	Het
Ncapd2	A	T	6: 125,184,328	M247K	possibly damaging	Het
Nlrp2	T	C	7: 5,317,534	D868G	probably damaging	Het
Npy6r	A	G	18: 44,275,932	N140S	probably damaging	Het
Nsmce4a	T	C	7: 130,539,872	K196E	probably benign	Het
Nup88	T	C	11: 70,945,254	K532R	probably benign	Het
Olfr424	T	A	1: 174,137,114	Y123*	probably null	Het
Olfr947-ps1	A	T	9: 39,289,293	I199N	unknown	Het
Olfr974	T	A	9: 39,942,509	V83E	probably benign	Het
Pbxip1	A	T	3: 89,447,428	D418V	possibly damaging	Het
Pde2a	C	A	7: 101,509,944	R761S	possibly damaging	Het
Phf10	A	T	17: 14,946,313	C432S	probably damaging	Het
Pitpnm2	T	C	5: 124,121,459	D1271G	probably damaging	Het
Plin1	A	T	7: 79,723,444	L259Q	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Pou6f2	T	A	13: 18,239,794	Q132L	unknown	Het
Ppa2	A	T	3: 133,330,438	N118Y	possibly damaging	Het
Prickle2	T	C	6: 92,410,978	E537G	possibly damaging	Het
Prl3d1	A	G	13: 27,098,701	I141V	possibly damaging	Het
Prl8a1	A	T	13: 27,574,189	V179D	probably damaging	Het
Prr14l	A	G	5: 32,827,145	F1669L	probably benign	Het
Prrg4	T	A	2: 104,839,442	E110V	possibly damaging	Het
Rfx5	C	A	3: 94,958,876	H495Q	unknown	Het
Rgl2	C	T	17: 33,933,429	R367W	probably damaging	Het
Rpe65	A	G	3: 159,622,854	Y433C	probably damaging	Het
Rtn4rl1	C	T	11: 75,265,750	S336F	possibly damaging	Het
Scn2a	A	G	2: 65,748,319	D1446G	probably benign	Het
Sdk1	C	A	5: 142,046,176	T1002K	probably benign	Het
Slc9b2	T	C	3: 135,330,661	S409P	probably benign	Het
Sowahc	A	G	10: 59,222,278	T79A	probably benign	Het
Stk35	T	A	2: 129,801,593	C166S	probably benign	Het
Tarbp2	A	G	15: 102,522,487	H225R	probably benign	Het
Tdrd12	T	A	7: 35,489,223	K530*	probably null	Het
Terf2ip	A	G	8: 112,017,986	I312V	probably benign	Het
Tgfb1	T	C	7: 25,692,539		probably null	Het
Thbs2	T	C	17: 14,671,458	D939G	probably damaging	Het
Ube4b	A	T	4: 149,398,610	I67K	probably benign	Het
Ubn1	G	T	16: 5,077,216	V709F	possibly damaging	Het
Ugt2b5	T	C	5: 87,128,399	K339E	possibly damaging	Het
Vax2	T	C	6: 83,737,900	S266P	probably damaging	Het
Vmn2r108	A	G	17: 20,462,776	I722T	probably benign	Het
Vmn2r95	A	G	17: 18,441,315	K441R	probably benign	Het
Wapl	C	A	14: 34,736,691	D903E	probably benign	Het
Wee1	T	A	7: 110,134,794	V442D	probably benign	Het
Zan	T	C	5: 137,434,096	N2313S	unknown	Het

Other mutations in Grm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01729:Grm7	APN	6	111246184	missense	probably benign	0.14
IGL02058:Grm7	APN	6	111358317	missense	probably damaging	1.00
IGL02650:Grm7	APN	6	111358958	missense	probably damaging	1.00
IGL02892:Grm7	APN	6	111254020	missense	probably damaging	0.99
IGL03074:Grm7	APN	6	111495643	splice site	probably null
IGL03185:Grm7	APN	6	110646222	missense	possibly damaging	0.84
Appropriated	UTSW	6	111495681	missense	possibly damaging	0.64
Consumed	UTSW	6	111358875	missense	probably damaging	1.00
Devoured	UTSW	6	111358824	missense	probably damaging	1.00
Ravaged	UTSW	6	111358913	missense	probably damaging	1.00
shaky	UTSW	6	111495791	nonsense	probably null
PIT4651001:Grm7	UTSW	6	110646089	missense	probably benign
R0539:Grm7	UTSW	6	111359094	splice site	probably benign
R0622:Grm7	UTSW	6	111358496	missense	probably damaging	1.00
R1356:Grm7	UTSW	6	111359024	missense	probably damaging	1.00
R1762:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1783:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1785:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1816:Grm7	UTSW	6	111495791	nonsense	probably null
R1823:Grm7	UTSW	6	111207769	missense	probably benign	0.17
R1864:Grm7	UTSW	6	111080423	missense	probably benign	0.03
R1894:Grm7	UTSW	6	111358607	missense	probably benign
R1987:Grm7	UTSW	6	110914511	missense	probably damaging	1.00
R1993:Grm7	UTSW	6	111207808	missense	probably benign	0.13
R2138:Grm7	UTSW	6	110646137	missense	probably damaging	1.00
R2214:Grm7	UTSW	6	111358997	missense	probably damaging	1.00
R2289:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2296:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2339:Grm7	UTSW	6	111495681	missense	possibly damaging	0.64
R2847:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2849:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2879:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2884:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2921:Grm7	UTSW	6	111495905	splice site	probably null
R2923:Grm7	UTSW	6	111495905	splice site	probably null
R3014:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3015:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3703:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3713:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3963:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4009:Grm7	UTSW	6	111495722	missense	probably damaging	1.00
R4091:Grm7	UTSW	6	110914340	missense	probably damaging	1.00
R4131:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4132:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4161:Grm7	UTSW	6	111254020	missense	probably damaging	0.99
R4329:Grm7	UTSW	6	110914364	missense	probably damaging	1.00
R4357:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4359:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	111246374	missense	probably benign	0.05
R4380:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4514:Grm7	UTSW	6	111358304	missense	possibly damaging	0.81
R4518:Grm7	UTSW	6	110914546	splice site	probably null
R4647:Grm7	UTSW	6	110914383	nonsense	probably null
R4714:Grm7	UTSW	6	111080422	missense	possibly damaging	0.52
R4775:Grm7	UTSW	6	110914371	missense	probably damaging	1.00
R4957:Grm7	UTSW	6	111358863	missense	probably damaging	1.00
R5056:Grm7	UTSW	6	111080443	missense	probably damaging	0.99
R5062:Grm7	UTSW	6	110646136	missense	probably damaging	1.00
R5256:Grm7	UTSW	6	111358221	missense	probably benign	0.01
R5431:Grm7	UTSW	6	111358426	missense	probably benign
R6026:Grm7	UTSW	6	111501539	nonsense	probably null
R6174:Grm7	UTSW	6	111246297	missense	probably benign
R6305:Grm7	UTSW	6	111358665	missense	probably damaging	1.00
R6318:Grm7	UTSW	6	111358875	missense	probably damaging	1.00
R6440:Grm7	UTSW	6	111254020	missense	probably damaging	1.00
R6519:Grm7	UTSW	6	111207752	missense	probably benign	0.00
R6531:Grm7	UTSW	6	111358425	missense	probably benign	0.29
R6888:Grm7	UTSW	6	111358353	missense	possibly damaging	0.79
R6949:Grm7	UTSW	6	110646304	missense	probably benign	0.03
R6949:Grm7	UTSW	6	111495729	missense	probably damaging	1.00
R6989:Grm7	UTSW	6	111207805	missense	probably damaging	1.00
R7076:Grm7	UTSW	6	111358152	missense	probably benign	0.04
R7208:Grm7	UTSW	6	111358569	missense	possibly damaging	0.94
R7217:Grm7	UTSW	6	111358824	missense	probably damaging	1.00
R7257:Grm7	UTSW	6	110646118	missense	probably damaging	1.00
R7297:Grm7	UTSW	6	110646013	missense	probably benign	0.16
R7470:Grm7	UTSW	6	111501515	missense
R7567:Grm7	UTSW	6	111358761	missense	probably damaging	0.96
R7806:Grm7	UTSW	6	111246353	nonsense	probably null
R8018:Grm7	UTSW	6	111207776	missense	probably benign	0.01
R8076:Grm7	UTSW	6	111566039	missense	probably damaging	1.00
R8409:Grm7	UTSW	6	110914336	missense	probably benign	0.02
R8420:Grm7	UTSW	6	111080354	missense	probably benign
R8523:Grm7	UTSW	6	111246319	missense	possibly damaging	0.76
R8816:Grm7	UTSW	6	111254005	missense	possibly damaging	0.46
R8958:Grm7	UTSW	6	111495822	missense	probably damaging	0.96
R9135:Grm7	UTSW	6	111495768	missense	probably benign	0.39
R9207:Grm7	UTSW	6	111358913	missense	probably damaging	1.00
R9210:Grm7	UTSW	6	110645908	missense	probably benign	0.01
R9438:Grm7	UTSW	6	111254116	missense	possibly damaging	0.94
R9448:Grm7	UTSW	6	111358232	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111358149	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111358490	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTGTCAGAACATCCCAATC -3'
(R):5'- ACTGGAGGTAATTGCCAGTTG -3'

Sequencing Primer
(F):5'- TCAAACTGGAGTGGCACTC -3'
(R):5'- CTGGAGGTAATTGCCAGTTGTGATG -3'

Posted On

2019-06-26