Mutagenetix > Incidental Mutation

Incidental Mutation 'R7203:Tgfb1'

560779

Institutional Source

Beutler Lab

Gene Symbol

Tgfb1

Ensembl Gene

ENSMUSG00000002603

Gene Name

transforming growth factor, beta 1

Synonyms

Tgfb, TGF-beta 1, TGFbeta1, Tgfb-1, TGF-beta1

MMRRC Submission

045281-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.575) question?

Stock #

R7203 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25687002-25705077 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 25692539 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000002678 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002678] [ENSMUST00000002678] [ENSMUST00000169009]

AlphaFold

P04202

Predicted Effect

probably null
Transcript: ENSMUST00000002678

SMART Domains

Protein: ENSMUSP00000002678
Gene: ENSMUSG00000002603

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
Pfam:TGFb_propeptide	29	261	3.2e-41	PFAM
TGFB	293	390	1.95e-39	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000002678

SMART Domains

Protein: ENSMUSP00000002678
Gene: ENSMUSG00000002603

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
Pfam:TGFb_propeptide	29	261	3.2e-41	PFAM
TGFB	293	390	1.95e-39	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169009

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (108/108)

MGI Phenotype

FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. Mice lacking a functional copy of this gene develop severe multifocal inflammatory disease, yolk sac defects and colon cancer. [provided by RefSeq, Aug 2016]
PHENOTYPE: Many homozygous null mutants die in utero by day 10.5 from yolk sac vasculature and hemopoietic defects. Survivors die by 5 weeks with wasting syndrome, excess inflammatory response and tissue necrosis. On BALB/c, mice develop necroinflammatory hepatitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544G11Rik	T	C	6: 65,953,333	V184A	probably benign	Het
4932415D10Rik	G	A	10: 82,293,414	T1254I	probably benign	Het
Aars2	A	G	17: 45,516,571	Y513C	probably damaging	Het
Ackr2	G	A	9: 121,908,967	C136Y	probably damaging	Het
Aldh1l1	A	G	6: 90,570,800	K414R	probably benign	Het
Arl9	A	G	5: 77,007,271	Y83C	possibly damaging	Het
Atp10a	G	T	7: 58,786,473	R337L	probably benign	Het
Atp6v1g3	A	T	1: 138,287,800	Q66L	probably damaging	Het
Atp7b	A	T	8: 21,997,335	N1321K	probably damaging	Het
Axdnd1	A	T	1: 156,382,389	M437K	probably damaging	Het
Bap1	C	A	14: 31,254,169	P147Q	probably damaging	Het
Bicd1	C	T	6: 149,512,905	T372I	possibly damaging	Het
Brix1	T	C	15: 10,483,292		probably null	Het
Btrc	A	G	19: 45,513,528		probably null	Het
C130050O18Rik	A	C	5: 139,414,374	I61L	probably benign	Het
Cfap161	A	G	7: 83,776,050	S278P	probably damaging	Het
Cgnl1	T	C	9: 71,724,533	D512G	possibly damaging	Het
Chat	T	C	14: 32,419,057	D461G	probably damaging	Het
Chl1	T	A	6: 103,691,674	V456D	probably benign	Het
Cib1	T	C	7: 80,232,372	T20A	possibly damaging	Het
Cubn	T	G	2: 13,351,003	H1806P	probably benign	Het
Dapk1	T	A	13: 60,696,335	V56E	possibly damaging	Het
Dennd4a	A	G	9: 64,896,474	N1032D	probably benign	Het
Dlg5	T	A	14: 24,138,655	E1756V	probably damaging	Het
Dnah1	T	C	14: 31,274,382	T2666A	probably benign	Het
Dnah11	A	T	12: 118,045,522	I2135N	possibly damaging	Het
Dnah6	T	A	6: 73,173,545	E745V	probably benign	Het
Dock8	A	T	19: 25,181,563	N1695I	probably damaging	Het
Esf1	C	T	2: 140,164,219	R336Q	possibly damaging	Het
Fam161a	A	G	11: 23,021,664		probably null	Het
Fam89a	T	C	8: 124,751,679	E44G	possibly damaging	Het
Fndc3b	A	T	3: 27,456,485	D829E	probably benign	Het
Fxr1	C	T	3: 34,046,540	T125I	possibly damaging	Het
Gfer	T	C	17: 24,695,862	D69G	probably damaging	Het
Gm16486	A	T	8: 70,716,948	E1229V	probably benign	Het
Gm2000	A	T	1: 156,366,087	I4F	probably damaging	Het
Gpatch2l	T	A	12: 86,288,937	S471T	probably benign	Het
Grm7	T	G	6: 111,358,569	I647S	possibly damaging	Het
Gsn	A	G	2: 35,298,795	I447V	probably benign	Het
H2al2c	C	T	Y: 2,599,234	L46F	possibly damaging	Het
Hao2	A	C	3: 98,877,282		probably null	Het
Ifitm10	T	C	7: 142,328,568	E155G	probably benign	Het
Igkv8-16	C	A	6: 70,386,810	W76L	probably benign	Het
Igsf21	A	T	4: 140,107,337	F75I	possibly damaging	Het
Ints14	T	A	9: 64,964,419	M13K	probably damaging	Het
Ipmk	A	T	10: 71,363,468	D53V	possibly damaging	Het
Itga8	A	G	2: 12,230,095	F451L	possibly damaging	Het
Jup	A	G	11: 100,381,734	F284S	probably damaging	Het
Kctd5	T	C	17: 24,073,235	D65G	probably benign	Het
Klrc1	A	T	6: 129,677,221	S148T	probably benign	Het
Kmt5b	A	G	19: 3,814,147	K404E	probably damaging	Het
Krt9	A	C	11: 100,190,791	M304R	probably damaging	Het
Krtap5-1	A	T	7: 142,296,562	S143T	unknown	Het
Kyat3	A	G	3: 142,720,401	N68D	probably damaging	Het
Kynu	A	G	2: 43,681,353	D427G	probably damaging	Het
Leo1	A	G	9: 75,445,996		probably null	Het
Loxhd1	A	G	18: 77,414,196	D1737G	probably damaging	Het
Lpo	C	A	11: 87,809,251	L521F	possibly damaging	Het
Lrrk1	A	G	7: 66,270,825	S1477P	probably damaging	Het
Lrrtm1	C	A	6: 77,243,601	L14M	probably damaging	Het
Ly75	G	A	2: 60,323,852	R1084*	probably null	Het
Mcf2l	A	G	8: 13,010,456	D764G	probably benign	Het
Mrgprd	A	T	7: 145,322,349	D319V	probably benign	Het
Mut	A	T	17: 40,938,673	M180L	probably benign	Het
Myom3	T	C	4: 135,795,179	L897P	possibly damaging	Het
Ncapd2	A	T	6: 125,184,328	M247K	possibly damaging	Het
Nlrp2	T	C	7: 5,317,534	D868G	probably damaging	Het
Npy6r	A	G	18: 44,275,932	N140S	probably damaging	Het
Nsmce4a	T	C	7: 130,539,872	K196E	probably benign	Het
Nup88	T	C	11: 70,945,254	K532R	probably benign	Het
Olfr424	T	A	1: 174,137,114	Y123*	probably null	Het
Olfr947-ps1	A	T	9: 39,289,293	I199N	unknown	Het
Olfr974	T	A	9: 39,942,509	V83E	probably benign	Het
Pbxip1	A	T	3: 89,447,428	D418V	possibly damaging	Het
Pde2a	C	A	7: 101,509,944	R761S	possibly damaging	Het
Phf10	A	T	17: 14,946,313	C432S	probably damaging	Het
Pitpnm2	T	C	5: 124,121,459	D1271G	probably damaging	Het
Plin1	A	T	7: 79,723,444	L259Q	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Pou6f2	T	A	13: 18,239,794	Q132L	unknown	Het
Ppa2	A	T	3: 133,330,438	N118Y	possibly damaging	Het
Prickle2	T	C	6: 92,410,978	E537G	possibly damaging	Het
Prl3d1	A	G	13: 27,098,701	I141V	possibly damaging	Het
Prl8a1	A	T	13: 27,574,189	V179D	probably damaging	Het
Prr14l	A	G	5: 32,827,145	F1669L	probably benign	Het
Prrg4	T	A	2: 104,839,442	E110V	possibly damaging	Het
Rfx5	C	A	3: 94,958,876	H495Q	unknown	Het
Rgl2	C	T	17: 33,933,429	R367W	probably damaging	Het
Rpe65	A	G	3: 159,622,854	Y433C	probably damaging	Het
Rtn4rl1	C	T	11: 75,265,750	S336F	possibly damaging	Het
Scn2a	A	G	2: 65,748,319	D1446G	probably benign	Het
Sdk1	C	A	5: 142,046,176	T1002K	probably benign	Het
Slc9b2	T	C	3: 135,330,661	S409P	probably benign	Het
Sowahc	A	G	10: 59,222,278	T79A	probably benign	Het
Stk35	T	A	2: 129,801,593	C166S	probably benign	Het
Tarbp2	A	G	15: 102,522,487	H225R	probably benign	Het
Tdrd12	T	A	7: 35,489,223	K530*	probably null	Het
Terf2ip	A	G	8: 112,017,986	I312V	probably benign	Het
Thbs2	T	C	17: 14,671,458	D939G	probably damaging	Het
Ube4b	A	T	4: 149,398,610	I67K	probably benign	Het
Ubn1	G	T	16: 5,077,216	V709F	possibly damaging	Het
Ugt2b5	T	C	5: 87,128,399	K339E	possibly damaging	Het
Vax2	T	C	6: 83,737,900	S266P	probably damaging	Het
Vmn2r108	A	G	17: 20,462,776	I722T	probably benign	Het
Vmn2r95	A	G	17: 18,441,315	K441R	probably benign	Het
Wapl	C	A	14: 34,736,691	D903E	probably benign	Het
Wee1	T	A	7: 110,134,794	V442D	probably benign	Het
Zan	T	C	5: 137,434,096	N2313S	unknown	Het

Other mutations in Tgfb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Tgfb1	APN	7	25688017	missense	probably damaging	1.00
IGL03028:Tgfb1	APN	7	25704196	missense	probably damaging	1.00
PIT4377001:Tgfb1	UTSW	7	25696918	missense	probably benign
R0004:Tgfb1	UTSW	7	25692366	splice site	probably benign
R0048:Tgfb1	UTSW	7	25694354	splice site	probably benign
R0048:Tgfb1	UTSW	7	25694354	splice site	probably benign
R0470:Tgfb1	UTSW	7	25687930	unclassified	probably benign
R1872:Tgfb1	UTSW	7	25692466	missense	probably damaging	1.00
R2178:Tgfb1	UTSW	7	25704809	missense	probably damaging	1.00
R4581:Tgfb1	UTSW	7	25697230	missense	possibly damaging	0.81
R5484:Tgfb1	UTSW	7	25688149	missense	probably benign	0.00
R5663:Tgfb1	UTSW	7	25694281	missense	possibly damaging	0.93
R5781:Tgfb1	UTSW	7	25696960	missense	probably benign	0.00
R6548:Tgfb1	UTSW	7	25696925	missense	probably benign	0.01
R6727:Tgfb1	UTSW	7	25689162	unclassified	probably benign
R7449:Tgfb1	UTSW	7	25704838	missense	probably damaging	1.00
R7654:Tgfb1	UTSW	7	25687695	unclassified	probably benign
R8257:Tgfb1	UTSW	7	25696948	missense	probably damaging	0.97
R9124:Tgfb1	UTSW	7	25689155	nonsense	probably null
R9418:Tgfb1	UTSW	7	25692527	missense	probably damaging	1.00
Z1177:Tgfb1	UTSW	7	25688208	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGACCTGACCTGATGTCTTCC -3'
(R):5'- ATAGGATGCAATCTGAGCGG -3'

Sequencing Primer
(F):5'- GACCTGATGTCTTCCTCCTTCTG -3'
(R):5'- GCAAGCGAATCTCTGTGAACTTG -3'

Posted On

2019-06-26