Incidental Mutation 'R0594:Myo3a'
ID56081
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Namemyosin IIIA
Synonyms9030416P08Rik
MMRRC Submission 038784-MU
Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0594 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location22227503-22618252 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 22544332 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749]
Predicted Effect probably benign
Transcript: ENSMUST00000044749
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 99% (119/120)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,389,880 V41A probably benign Het
Acad11 A G 9: 104,095,563 Q367R probably benign Het
Ackr4 A G 9: 104,099,004 V248A possibly damaging Het
Adamts14 T C 10: 61,202,887 E945G probably damaging Het
Akap2 A G 4: 57,856,752 T694A probably benign Het
Ano2 A G 6: 125,982,765 M663V probably damaging Het
Apc2 T A 10: 80,306,256 C336* probably null Het
Arhgap17 A G 7: 123,294,518 S560P probably benign Het
Arl5a T C 2: 52,405,014 D128G probably damaging Het
Atp6v0a2 C A 5: 124,717,982 R678S probably benign Het
B4galnt2 C A 11: 95,891,909 A26S probably benign Het
C1qtnf1 A T 11: 118,446,628 T95S possibly damaging Het
Ccdc188 T A 16: 18,218,920 F241L probably benign Het
Cdh19 A T 1: 110,925,867 D281E probably benign Het
Cdk5rap2 T C 4: 70,354,813 E241G probably damaging Het
Cherp A T 8: 72,462,402 probably null Het
Cpne9 T A 6: 113,290,400 probably benign Het
Cthrc1 A T 15: 39,077,142 R47W possibly damaging Het
Dcaf13 A G 15: 39,123,268 E145G probably benign Het
Dcaf4 T A 12: 83,538,043 probably null Het
Dgka A C 10: 128,733,110 probably benign Het
Dhrs13 T A 11: 78,034,525 F157L probably damaging Het
Dnajb5 A T 4: 42,956,577 Y88F probably damaging Het
Dpp8 A G 9: 65,036,998 T16A probably damaging Het
Dscc1 A T 15: 55,089,052 I91K possibly damaging Het
Efemp2 T A 19: 5,475,063 probably benign Het
Elf2 T C 3: 51,256,453 T504A possibly damaging Het
Elk3 G A 10: 93,265,160 S243F probably damaging Het
Ell2 A G 13: 75,749,993 D93G probably damaging Het
Eln G T 5: 134,712,398 probably benign Het
Eme1 C T 11: 94,650,430 D189N possibly damaging Het
Epb41l2 A G 10: 25,443,770 E167G possibly damaging Het
Exoc5 A T 14: 49,036,087 probably benign Het
Fam129c C A 8: 71,599,135 A38E probably benign Het
Fam170b A G 14: 32,836,314 K369E unknown Het
Fam187b T A 7: 30,977,154 C29* probably null Het
Fam20c T C 5: 138,766,637 S260P possibly damaging Het
Fam216b G A 14: 78,086,674 A21V possibly damaging Het
Fam98a A T 17: 75,538,487 Y421* probably null Het
Farp2 T C 1: 93,576,500 V333A probably damaging Het
Fcgr1 T C 3: 96,292,312 Y93C probably damaging Het
Fgd2 A T 17: 29,365,552 I157F probably damaging Het
Frmd4b T A 6: 97,325,426 probably benign Het
Fut9 T C 4: 25,620,526 D96G possibly damaging Het
Glt8d1 G A 14: 31,010,410 probably null Het
Gm7579 T A 7: 142,212,384 C176S unknown Het
Gmpr2 A G 14: 55,677,988 E272G probably damaging Het
Grin2b T C 6: 135,733,929 H873R probably damaging Het
Gtf2i C T 5: 134,242,173 probably benign Het
Htr3b A T 9: 48,947,631 V69E probably benign Het
Icam5 A G 9: 21,035,598 N474S probably benign Het
Itgal T A 7: 127,314,060 S610T probably damaging Het
Jag1 T A 2: 137,087,080 I819L probably damaging Het
Kif9 A T 9: 110,511,340 E467V probably benign Het
Krit1 T C 5: 3,823,694 L491P possibly damaging Het
Lipo2 T G 19: 33,746,902 I155L possibly damaging Het
Lmbr1 A G 5: 29,292,209 F65L possibly damaging Het
Lsp1 G A 7: 142,488,950 probably benign Het
Marc2 T C 1: 184,841,339 N121D probably benign Het
Mgat5 T A 1: 127,412,248 D455E probably damaging Het
Mical2 A T 7: 112,318,450 Y338F probably damaging Het
Mkl1 G A 15: 81,017,174 T372I probably damaging Het
Mre11a T G 9: 14,815,209 S396A probably benign Het
Naca T C 10: 128,040,355 probably benign Het
Nav1 A T 1: 135,467,643 I996K possibly damaging Het
Ncbp1 A G 4: 46,170,551 N742S probably benign Het
Ndufaf3 G A 9: 108,566,923 A2V probably benign Het
Ntn5 G T 7: 45,686,681 A47S probably damaging Het
Olfr1122 T A 2: 87,387,954 I83N probably damaging Het
Olfr13 T A 6: 43,174,607 V207E possibly damaging Het
Olfr1502 G T 19: 13,862,279 C162F probably benign Het
Olfr384 G A 11: 73,603,392 E271K probably benign Het
Olfr392 T C 11: 73,814,617 H155R probably benign Het
Olfr777 T C 10: 129,269,152 Y57C possibly damaging Het
Otud7a T A 7: 63,727,472 L203* probably null Het
Pcdhb13 A G 18: 37,443,931 Y454C probably damaging Het
Pdzph1 C T 17: 58,954,479 V853M possibly damaging Het
Plec A G 15: 76,172,253 S4517P probably damaging Het
Pm20d2 C T 4: 33,181,746 E286K probably damaging Het
Polr2i T A 7: 30,232,745 probably null Het
Ppp1r12b A G 1: 134,776,479 L879P probably damaging Het
Prf1 C A 10: 61,303,722 Y486* probably null Het
Qsox2 T G 2: 26,214,044 T325P probably damaging Het
Rab1b G T 19: 5,100,656 probably benign Het
Rbm19 T C 5: 120,128,316 probably null Het
Rhobtb2 A G 14: 69,793,948 V576A probably benign Het
Rnps1 G A 17: 24,424,437 V215M probably damaging Het
Rps11 A G 7: 45,124,282 probably benign Het
Serpinb3d C T 1: 107,079,347 M210I probably damaging Het
Sgsm1 T C 5: 113,310,562 T17A probably benign Het
Slc6a3 A G 13: 73,538,642 T43A probably damaging Het
Sox4 C G 13: 28,952,904 A40P probably damaging Het
Spry2 A T 14: 105,893,310 D147E possibly damaging Het
Stpg1 A G 4: 135,519,431 N157D possibly damaging Het
Sumf1 T C 6: 108,173,414 D152G probably benign Het
Tbr1 T C 2: 61,811,620 S410P possibly damaging Het
Tdrd6 A G 17: 43,629,383 V258A probably damaging Het
Tirap C T 9: 35,188,761 G209D probably damaging Het
Tnfrsf8 A T 4: 145,296,861 V134D probably damaging Het
Tnr A G 1: 159,850,335 T97A probably benign Het
Tspan32 T A 7: 143,015,610 F135L probably damaging Het
Ttn T C 2: 76,789,056 K16021E probably damaging Het
Tusc3 T A 8: 39,096,968 I251N probably damaging Het
Usp38 A T 8: 81,005,366 I305N probably damaging Het
Usp4 T A 9: 108,370,881 probably null Het
Usp5 A T 6: 124,817,424 D764E probably damaging Het
Vangl2 A T 1: 172,004,657 V544E probably damaging Het
Vldlr G A 19: 27,234,819 V78M probably damaging Het
Vmn1r29 T C 6: 58,307,772 V159A probably benign Het
Vmn2r16 T A 5: 109,363,896 F656L probably damaging Het
Wdfy3 T A 5: 101,906,185 I1590F possibly damaging Het
Xpo1 T A 11: 23,280,402 V263E probably damaging Het
Zbtb38 A G 9: 96,685,954 S1026P probably damaging Het
Zfp407 A T 18: 84,562,567 D140E possibly damaging Het
Zfp637 T A 6: 117,845,686 Y258* probably null Het
Zfp951 T A 5: 104,814,572 Q376L possibly damaging Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
lose UTSW 2 22558320 nonsense probably null
snooze UTSW 2 22282634 missense probably damaging 0.99
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
PIT4445001:Myo3a UTSW 2 22542415 missense possibly damaging 0.64
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1443:Myo3a UTSW 2 22282626 missense probably damaging 0.99
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1917:Myo3a UTSW 2 22291922 missense probably damaging 1.00
R1920:Myo3a UTSW 2 22564996 missense probably benign 0.02
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2115:Myo3a UTSW 2 22245531 missense probably damaging 1.00
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3196:Myo3a UTSW 2 22399868 missense possibly damaging 0.86
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5032:Myo3a UTSW 2 22282602 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5502:Myo3a UTSW 2 22558369 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6479:Myo3a UTSW 2 22577865 missense probably benign 0.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
R7001:Myo3a UTSW 2 22332377 missense probably benign 0.04
R7215:Myo3a UTSW 2 22245567 missense possibly damaging 0.78
R7301:Myo3a UTSW 2 22544466 critical splice donor site probably null
R7318:Myo3a UTSW 2 22558320 nonsense probably null
R7447:Myo3a UTSW 2 22544426 missense probably benign 0.27
R7456:Myo3a UTSW 2 22407444 missense probably benign 0.08
R7528:Myo3a UTSW 2 22266114 nonsense probably null
R7731:Myo3a UTSW 2 22282589 missense probably damaging 1.00
R7768:Myo3a UTSW 2 22241143 missense probably damaging 0.99
R8054:Myo3a UTSW 2 22574317 missense probably benign 0.00
Z1177:Myo3a UTSW 2 22618140 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- ATGCTTCCCGTCCCTCCAAATAAAG -3'
(R):5'- TGCCCATTCCTGAAAATGGCAGAC -3'

Sequencing Primer
(F):5'- TAAAGAAAAGCAGCATACCAGATTC -3'
(R):5'- TTCGAGTAGAGTGAACTCTTCC -3'
Posted On2013-07-11