Mutagenetix > Incidental Mutation

Incidental Mutation 'R0594:Myo3a'

56081

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

038784-MU

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0594 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 22544332 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000046329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000044749

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.6%

Validation Efficiency

99% (119/120)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	T	C	16: 14,389,880	V41A	probably benign	Het
Acad11	A	G	9: 104,095,563	Q367R	probably benign	Het
Ackr4	A	G	9: 104,099,004	V248A	possibly damaging	Het
Adamts14	T	C	10: 61,202,887	E945G	probably damaging	Het
Akap2	A	G	4: 57,856,752	T694A	probably benign	Het
Ano2	A	G	6: 125,982,765	M663V	probably damaging	Het
Apc2	T	A	10: 80,306,256	C336*	probably null	Het
Arhgap17	A	G	7: 123,294,518	S560P	probably benign	Het
Arl5a	T	C	2: 52,405,014	D128G	probably damaging	Het
Atp6v0a2	C	A	5: 124,717,982	R678S	probably benign	Het
B4galnt2	C	A	11: 95,891,909	A26S	probably benign	Het
C1qtnf1	A	T	11: 118,446,628	T95S	possibly damaging	Het
Ccdc188	T	A	16: 18,218,920	F241L	probably benign	Het
Cdh19	A	T	1: 110,925,867	D281E	probably benign	Het
Cdk5rap2	T	C	4: 70,354,813	E241G	probably damaging	Het
Cherp	A	T	8: 72,462,402		probably null	Het
Cpne9	T	A	6: 113,290,400		probably benign	Het
Cthrc1	A	T	15: 39,077,142	R47W	possibly damaging	Het
Dcaf13	A	G	15: 39,123,268	E145G	probably benign	Het
Dcaf4	T	A	12: 83,538,043		probably null	Het
Dgka	A	C	10: 128,733,110		probably benign	Het
Dhrs13	T	A	11: 78,034,525	F157L	probably damaging	Het
Dnajb5	A	T	4: 42,956,577	Y88F	probably damaging	Het
Dpp8	A	G	9: 65,036,998	T16A	probably damaging	Het
Dscc1	A	T	15: 55,089,052	I91K	possibly damaging	Het
Efemp2	T	A	19: 5,475,063		probably benign	Het
Elf2	T	C	3: 51,256,453	T504A	possibly damaging	Het
Elk3	G	A	10: 93,265,160	S243F	probably damaging	Het
Ell2	A	G	13: 75,749,993	D93G	probably damaging	Het
Eln	G	T	5: 134,712,398		probably benign	Het
Eme1	C	T	11: 94,650,430	D189N	possibly damaging	Het
Epb41l2	A	G	10: 25,443,770	E167G	possibly damaging	Het
Exoc5	A	T	14: 49,036,087		probably benign	Het
Fam129c	C	A	8: 71,599,135	A38E	probably benign	Het
Fam170b	A	G	14: 32,836,314	K369E	unknown	Het
Fam187b	T	A	7: 30,977,154	C29*	probably null	Het
Fam20c	T	C	5: 138,766,637	S260P	possibly damaging	Het
Fam216b	G	A	14: 78,086,674	A21V	possibly damaging	Het
Fam98a	A	T	17: 75,538,487	Y421*	probably null	Het
Farp2	T	C	1: 93,576,500	V333A	probably damaging	Het
Fcgr1	T	C	3: 96,292,312	Y93C	probably damaging	Het
Fgd2	A	T	17: 29,365,552	I157F	probably damaging	Het
Frmd4b	T	A	6: 97,325,426		probably benign	Het
Fut9	T	C	4: 25,620,526	D96G	possibly damaging	Het
Glt8d1	G	A	14: 31,010,410		probably null	Het
Gm7579	T	A	7: 142,212,384	C176S	unknown	Het
Gmpr2	A	G	14: 55,677,988	E272G	probably damaging	Het
Grin2b	T	C	6: 135,733,929	H873R	probably damaging	Het
Gtf2i	C	T	5: 134,242,173		probably benign	Het
Htr3b	A	T	9: 48,947,631	V69E	probably benign	Het
Icam5	A	G	9: 21,035,598	N474S	probably benign	Het
Itgal	T	A	7: 127,314,060	S610T	probably damaging	Het
Jag1	T	A	2: 137,087,080	I819L	probably damaging	Het
Kif9	A	T	9: 110,511,340	E467V	probably benign	Het
Krit1	T	C	5: 3,823,694	L491P	possibly damaging	Het
Lipo2	T	G	19: 33,746,902	I155L	possibly damaging	Het
Lmbr1	A	G	5: 29,292,209	F65L	possibly damaging	Het
Lsp1	G	A	7: 142,488,950		probably benign	Het
Marc2	T	C	1: 184,841,339	N121D	probably benign	Het
Mgat5	T	A	1: 127,412,248	D455E	probably damaging	Het
Mical2	A	T	7: 112,318,450	Y338F	probably damaging	Het
Mkl1	G	A	15: 81,017,174	T372I	probably damaging	Het
Mre11a	T	G	9: 14,815,209	S396A	probably benign	Het
Naca	T	C	10: 128,040,355		probably benign	Het
Nav1	A	T	1: 135,467,643	I996K	possibly damaging	Het
Ncbp1	A	G	4: 46,170,551	N742S	probably benign	Het
Ndufaf3	G	A	9: 108,566,923	A2V	probably benign	Het
Ntn5	G	T	7: 45,686,681	A47S	probably damaging	Het
Olfr1122	T	A	2: 87,387,954	I83N	probably damaging	Het
Olfr13	T	A	6: 43,174,607	V207E	possibly damaging	Het
Olfr1502	G	T	19: 13,862,279	C162F	probably benign	Het
Olfr384	G	A	11: 73,603,392	E271K	probably benign	Het
Olfr392	T	C	11: 73,814,617	H155R	probably benign	Het
Olfr777	T	C	10: 129,269,152	Y57C	possibly damaging	Het
Otud7a	T	A	7: 63,727,472	L203*	probably null	Het
Pcdhb13	A	G	18: 37,443,931	Y454C	probably damaging	Het
Pdzph1	C	T	17: 58,954,479	V853M	possibly damaging	Het
Plec	A	G	15: 76,172,253	S4517P	probably damaging	Het
Pm20d2	C	T	4: 33,181,746	E286K	probably damaging	Het
Polr2i	T	A	7: 30,232,745		probably null	Het
Ppp1r12b	A	G	1: 134,776,479	L879P	probably damaging	Het
Prf1	C	A	10: 61,303,722	Y486*	probably null	Het
Qsox2	T	G	2: 26,214,044	T325P	probably damaging	Het
Rab1b	G	T	19: 5,100,656		probably benign	Het
Rbm19	T	C	5: 120,128,316		probably null	Het
Rhobtb2	A	G	14: 69,793,948	V576A	probably benign	Het
Rnps1	G	A	17: 24,424,437	V215M	probably damaging	Het
Rps11	A	G	7: 45,124,282		probably benign	Het
Serpinb3d	C	T	1: 107,079,347	M210I	probably damaging	Het
Sgsm1	T	C	5: 113,310,562	T17A	probably benign	Het
Slc6a3	A	G	13: 73,538,642	T43A	probably damaging	Het
Sox4	C	G	13: 28,952,904	A40P	probably damaging	Het
Spry2	A	T	14: 105,893,310	D147E	possibly damaging	Het
Stpg1	A	G	4: 135,519,431	N157D	possibly damaging	Het
Sumf1	T	C	6: 108,173,414	D152G	probably benign	Het
Tbr1	T	C	2: 61,811,620	S410P	possibly damaging	Het
Tdrd6	A	G	17: 43,629,383	V258A	probably damaging	Het
Tirap	C	T	9: 35,188,761	G209D	probably damaging	Het
Tnfrsf8	A	T	4: 145,296,861	V134D	probably damaging	Het
Tnr	A	G	1: 159,850,335	T97A	probably benign	Het
Tspan32	T	A	7: 143,015,610	F135L	probably damaging	Het
Ttn	T	C	2: 76,789,056	K16021E	probably damaging	Het
Tusc3	T	A	8: 39,096,968	I251N	probably damaging	Het
Usp38	A	T	8: 81,005,366	I305N	probably damaging	Het
Usp4	T	A	9: 108,370,881		probably null	Het
Usp5	A	T	6: 124,817,424	D764E	probably damaging	Het
Vangl2	A	T	1: 172,004,657	V544E	probably damaging	Het
Vldlr	G	A	19: 27,234,819	V78M	probably damaging	Het
Vmn1r29	T	C	6: 58,307,772	V159A	probably benign	Het
Vmn2r16	T	A	5: 109,363,896	F656L	probably damaging	Het
Wdfy3	T	A	5: 101,906,185	I1590F	possibly damaging	Het
Xpo1	T	A	11: 23,280,402	V263E	probably damaging	Het
Zbtb38	A	G	9: 96,685,954	S1026P	probably damaging	Het
Zfp407	A	T	18: 84,562,567	D140E	possibly damaging	Het
Zfp637	T	A	6: 117,845,686	Y258*	probably null	Het
Zfp951	T	A	5: 104,814,572	Q376L	possibly damaging	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
R8708:Myo3a	UTSW	2	22291796	splice site	probably benign
R8757:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8759:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8779:Myo3a	UTSW	2	22245593	nonsense	probably null
R8828:Myo3a	UTSW	2	22241053	missense	probably benign	0.01
R8910:Myo3a	UTSW	2	22574268	missense	probably benign	0.01
R8916:Myo3a	UTSW	2	22567692	missense	probably damaging	1.00
R8926:Myo3a	UTSW	2	22396263	missense	possibly damaging	0.95
R9028:Myo3a	UTSW	2	22600087	missense	possibly damaging	0.79
R9046:Myo3a	UTSW	2	22558355	missense	probably damaging	0.99
R9120:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R9153:Myo3a	UTSW	2	22399933	missense	probably benign	0.02
R9191:Myo3a	UTSW	2	22579829	missense	probably benign	0.24
R9258:Myo3a	UTSW	2	22577533	missense	possibly damaging	0.60
R9436:Myo3a	UTSW	2	22407424	nonsense	probably null
R9464:Myo3a	UTSW	2	22227572	start gained	probably benign
R9487:Myo3a	UTSW	2	22241051	missense	probably benign
R9719:Myo3a	UTSW	2	22544455	missense	probably benign	0.02
R9799:Myo3a	UTSW	2	22600169	missense	probably damaging	1.00
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- ATGCTTCCCGTCCCTCCAAATAAAG -3'
(R):5'- TGCCCATTCCTGAAAATGGCAGAC -3'

Sequencing Primer
(F):5'- TAAAGAAAAGCAGCATACCAGATTC -3'
(R):5'- TTCGAGTAGAGTGAACTCTTCC -3'

Posted On

2013-07-11