Mutagenetix > Incidental Mutation

Incidental Mutation 'R7203:Dnah11'

560812

Institutional Source

Beutler Lab

Gene Symbol

Dnah11

Ensembl Gene

ENSMUSG00000018581

Gene Name

dynein, axonemal, heavy chain 11

Synonyms

b2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo

MMRRC Submission

045281-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.458) question?

Stock #

R7203 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

117877982-118199043 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118045522 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 2135 (I2135N)

Ref Sequence

ENSEMBL: ENSMUSP00000081867 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084806]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084806
AA Change: I2135N

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: I2135N

Domain	Start	End	E-Value	Type
low complexity region	18	28	N/A	INTRINSIC
Pfam:DHC_N1	218	794	1.6e-162	PFAM
low complexity region	1266	1282	N/A	INTRINSIC
Pfam:DHC_N2	1297	1705	1e-130	PFAM
low complexity region	1757	1773	N/A	INTRINSIC
AAA	1869	1963	1.51e0	SMART
Pfam:AAA_5	2150	2286	1.6e-12	PFAM
AAA	2474	2619	1.48e-1	SMART
AAA	2819	2931	4.57e-1	SMART
Pfam:MT	3069	3413	3.2e-162	PFAM
Pfam:AAA_9	3434	3656	2.9e-88	PFAM
Pfam:Dynein_heavy	3790	4486	7.1e-235	PFAM

Predicted Effect

Meta Mutation Damage Score

0.2850

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (108/108)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544G11Rik	T	C	6: 65,953,333	V184A	probably benign	Het
4932415D10Rik	G	A	10: 82,293,414	T1254I	probably benign	Het
Aars2	A	G	17: 45,516,571	Y513C	probably damaging	Het
Ackr2	G	A	9: 121,908,967	C136Y	probably damaging	Het
Aldh1l1	A	G	6: 90,570,800	K414R	probably benign	Het
Arl9	A	G	5: 77,007,271	Y83C	possibly damaging	Het
Atp10a	G	T	7: 58,786,473	R337L	probably benign	Het
Atp6v1g3	A	T	1: 138,287,800	Q66L	probably damaging	Het
Atp7b	A	T	8: 21,997,335	N1321K	probably damaging	Het
Axdnd1	A	T	1: 156,382,389	M437K	probably damaging	Het
Bap1	C	A	14: 31,254,169	P147Q	probably damaging	Het
Bicd1	C	T	6: 149,512,905	T372I	possibly damaging	Het
Brix1	T	C	15: 10,483,292		probably null	Het
Btrc	A	G	19: 45,513,528		probably null	Het
C130050O18Rik	A	C	5: 139,414,374	I61L	probably benign	Het
Cfap161	A	G	7: 83,776,050	S278P	probably damaging	Het
Cgnl1	T	C	9: 71,724,533	D512G	possibly damaging	Het
Chat	T	C	14: 32,419,057	D461G	probably damaging	Het
Chl1	T	A	6: 103,691,674	V456D	probably benign	Het
Cib1	T	C	7: 80,232,372	T20A	possibly damaging	Het
Cubn	T	G	2: 13,351,003	H1806P	probably benign	Het
Dapk1	T	A	13: 60,696,335	V56E	possibly damaging	Het
Dennd4a	A	G	9: 64,896,474	N1032D	probably benign	Het
Dlg5	T	A	14: 24,138,655	E1756V	probably damaging	Het
Dnah1	T	C	14: 31,274,382	T2666A	probably benign	Het
Dnah6	T	A	6: 73,173,545	E745V	probably benign	Het
Dock8	A	T	19: 25,181,563	N1695I	probably damaging	Het
Esf1	C	T	2: 140,164,219	R336Q	possibly damaging	Het
Fam161a	A	G	11: 23,021,664		probably null	Het
Fam89a	T	C	8: 124,751,679	E44G	possibly damaging	Het
Fndc3b	A	T	3: 27,456,485	D829E	probably benign	Het
Fxr1	C	T	3: 34,046,540	T125I	possibly damaging	Het
Gfer	T	C	17: 24,695,862	D69G	probably damaging	Het
Gm16486	A	T	8: 70,716,948	E1229V	probably benign	Het
Gm2000	A	T	1: 156,366,087	I4F	probably damaging	Het
Gpatch2l	T	A	12: 86,288,937	S471T	probably benign	Het
Grm7	T	G	6: 111,358,569	I647S	possibly damaging	Het
Gsn	A	G	2: 35,298,795	I447V	probably benign	Het
H2al2c	C	T	Y: 2,599,234	L46F	possibly damaging	Het
Hao2	A	C	3: 98,877,282		probably null	Het
Ifitm10	T	C	7: 142,328,568	E155G	probably benign	Het
Igkv8-16	C	A	6: 70,386,810	W76L	probably benign	Het
Igsf21	A	T	4: 140,107,337	F75I	possibly damaging	Het
Ints14	T	A	9: 64,964,419	M13K	probably damaging	Het
Ipmk	A	T	10: 71,363,468	D53V	possibly damaging	Het
Itga8	A	G	2: 12,230,095	F451L	possibly damaging	Het
Jup	A	G	11: 100,381,734	F284S	probably damaging	Het
Kctd5	T	C	17: 24,073,235	D65G	probably benign	Het
Klrc1	A	T	6: 129,677,221	S148T	probably benign	Het
Kmt5b	A	G	19: 3,814,147	K404E	probably damaging	Het
Krt9	A	C	11: 100,190,791	M304R	probably damaging	Het
Krtap5-1	A	T	7: 142,296,562	S143T	unknown	Het
Kyat3	A	G	3: 142,720,401	N68D	probably damaging	Het
Kynu	A	G	2: 43,681,353	D427G	probably damaging	Het
Leo1	A	G	9: 75,445,996		probably null	Het
Loxhd1	A	G	18: 77,414,196	D1737G	probably damaging	Het
Lpo	C	A	11: 87,809,251	L521F	possibly damaging	Het
Lrrk1	A	G	7: 66,270,825	S1477P	probably damaging	Het
Lrrtm1	C	A	6: 77,243,601	L14M	probably damaging	Het
Ly75	G	A	2: 60,323,852	R1084*	probably null	Het
Mcf2l	A	G	8: 13,010,456	D764G	probably benign	Het
Mrgprd	A	T	7: 145,322,349	D319V	probably benign	Het
Mut	A	T	17: 40,938,673	M180L	probably benign	Het
Myom3	T	C	4: 135,795,179	L897P	possibly damaging	Het
Ncapd2	A	T	6: 125,184,328	M247K	possibly damaging	Het
Nlrp2	T	C	7: 5,317,534	D868G	probably damaging	Het
Npy6r	A	G	18: 44,275,932	N140S	probably damaging	Het
Nsmce4a	T	C	7: 130,539,872	K196E	probably benign	Het
Nup88	T	C	11: 70,945,254	K532R	probably benign	Het
Olfr424	T	A	1: 174,137,114	Y123*	probably null	Het
Olfr947-ps1	A	T	9: 39,289,293	I199N	unknown	Het
Olfr974	T	A	9: 39,942,509	V83E	probably benign	Het
Pbxip1	A	T	3: 89,447,428	D418V	possibly damaging	Het
Pde2a	C	A	7: 101,509,944	R761S	possibly damaging	Het
Phf10	A	T	17: 14,946,313	C432S	probably damaging	Het
Pitpnm2	T	C	5: 124,121,459	D1271G	probably damaging	Het
Plin1	A	T	7: 79,723,444	L259Q	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Pou6f2	T	A	13: 18,239,794	Q132L	unknown	Het
Ppa2	A	T	3: 133,330,438	N118Y	possibly damaging	Het
Prickle2	T	C	6: 92,410,978	E537G	possibly damaging	Het
Prl3d1	A	G	13: 27,098,701	I141V	possibly damaging	Het
Prl8a1	A	T	13: 27,574,189	V179D	probably damaging	Het
Prr14l	A	G	5: 32,827,145	F1669L	probably benign	Het
Prrg4	T	A	2: 104,839,442	E110V	possibly damaging	Het
Rfx5	C	A	3: 94,958,876	H495Q	unknown	Het
Rgl2	C	T	17: 33,933,429	R367W	probably damaging	Het
Rpe65	A	G	3: 159,622,854	Y433C	probably damaging	Het
Rtn4rl1	C	T	11: 75,265,750	S336F	possibly damaging	Het
Scn2a	A	G	2: 65,748,319	D1446G	probably benign	Het
Sdk1	C	A	5: 142,046,176	T1002K	probably benign	Het
Slc9b2	T	C	3: 135,330,661	S409P	probably benign	Het
Sowahc	A	G	10: 59,222,278	T79A	probably benign	Het
Stk35	T	A	2: 129,801,593	C166S	probably benign	Het
Tarbp2	A	G	15: 102,522,487	H225R	probably benign	Het
Tdrd12	T	A	7: 35,489,223	K530*	probably null	Het
Terf2ip	A	G	8: 112,017,986	I312V	probably benign	Het
Tgfb1	T	C	7: 25,692,539		probably null	Het
Thbs2	T	C	17: 14,671,458	D939G	probably damaging	Het
Ube4b	A	T	4: 149,398,610	I67K	probably benign	Het
Ubn1	G	T	16: 5,077,216	V709F	possibly damaging	Het
Ugt2b5	T	C	5: 87,128,399	K339E	possibly damaging	Het
Vax2	T	C	6: 83,737,900	S266P	probably damaging	Het
Vmn2r108	A	G	17: 20,462,776	I722T	probably benign	Het
Vmn2r95	A	G	17: 18,441,315	K441R	probably benign	Het
Wapl	C	A	14: 34,736,691	D903E	probably benign	Het
Wee1	T	A	7: 110,134,794	V442D	probably benign	Het
Zan	T	C	5: 137,434,096	N2313S	unknown	Het

Other mutations in Dnah11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Dnah11	APN	12	118198745	missense	probably benign	0.28
IGL00422:Dnah11	APN	12	118068096	missense	probably damaging	1.00
IGL00436:Dnah11	APN	12	118036459	missense	possibly damaging	0.56
IGL00540:Dnah11	APN	12	118186922	missense	probably benign	0.01
IGL00687:Dnah11	APN	12	117922004	splice site	probably benign
IGL00833:Dnah11	APN	12	118179580	missense	probably damaging	1.00
IGL00906:Dnah11	APN	12	117911202	missense	probably damaging	1.00
IGL00952:Dnah11	APN	12	118196651	missense	possibly damaging	0.56
IGL01111:Dnah11	APN	12	118142934	splice site	probably benign
IGL01121:Dnah11	APN	12	118050695	missense	probably benign	0.02
IGL01143:Dnah11	APN	12	118012740	missense	probably damaging	1.00
IGL01359:Dnah11	APN	12	117982999	missense	probably damaging	0.99
IGL01372:Dnah11	APN	12	118192399	missense	probably damaging	1.00
IGL01410:Dnah11	APN	12	118047256	nonsense	probably null
IGL01418:Dnah11	APN	12	117987482	nonsense	probably null
IGL01444:Dnah11	APN	12	118020232	missense	possibly damaging	0.91
IGL01606:Dnah11	APN	12	117983032	missense	probably benign	0.15
IGL01645:Dnah11	APN	12	118186998	missense	possibly damaging	0.90
IGL01932:Dnah11	APN	12	118192270	splice site	probably benign
IGL02104:Dnah11	APN	12	118192390	missense	probably benign
IGL02151:Dnah11	APN	12	118059888	splice site	probably benign
IGL02189:Dnah11	APN	12	118082579	missense	probably benign	0.00
IGL02417:Dnah11	APN	12	118057180	missense	probably damaging	1.00
IGL02421:Dnah11	APN	12	118186902	missense	probably damaging	1.00
IGL02444:Dnah11	APN	12	117975873	splice site	probably benign
IGL02474:Dnah11	APN	12	118027445	splice site	probably null
IGL02526:Dnah11	APN	12	118179618	missense	possibly damaging	0.70
IGL02887:Dnah11	APN	12	117911040	missense	probably damaging	1.00
IGL03011:Dnah11	APN	12	118012377	missense	probably benign	0.08
IGL03061:Dnah11	APN	12	117903121	missense	probably damaging	1.00
IGL03182:Dnah11	APN	12	118030291	missense	probably damaging	0.99
IGL03220:Dnah11	APN	12	118105985	missense	probably benign
IGL03238:Dnah11	APN	12	118109898	missense	probably damaging	1.00
IGL03493:Dnah11	APN	12	118012798	missense	probably benign	0.00
P0045:Dnah11	UTSW	12	118030327	missense	probably benign
R0009:Dnah11	UTSW	12	118045522	missense	possibly damaging	0.90
R0066:Dnah11	UTSW	12	118126886	missense	probably benign	0.05
R0172:Dnah11	UTSW	12	117987453	missense	probably damaging	1.00
R0206:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0206:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0208:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0230:Dnah11	UTSW	12	117983056	nonsense	probably null
R0270:Dnah11	UTSW	12	118041013	missense	probably damaging	1.00
R0311:Dnah11	UTSW	12	118127133	missense	probably benign	0.03
R0325:Dnah11	UTSW	12	118012339	missense	probably benign
R0370:Dnah11	UTSW	12	117995227	missense	probably benign
R0416:Dnah11	UTSW	12	117911058	missense	probably damaging	1.00
R0505:Dnah11	UTSW	12	118106510	missense	probably damaging	1.00
R0540:Dnah11	UTSW	12	118082511	missense	probably damaging	1.00
R0554:Dnah11	UTSW	12	117931178	missense	probably benign	0.01
R0607:Dnah11	UTSW	12	118082511	missense	probably damaging	1.00
R0620:Dnah11	UTSW	12	117987469	missense	probably damaging	1.00
R0635:Dnah11	UTSW	12	118007996	missense	probably damaging	1.00
R0755:Dnah11	UTSW	12	117954829	missense	possibly damaging	0.95
R0755:Dnah11	UTSW	12	118198625	missense	probably benign	0.17
R0789:Dnah11	UTSW	12	117911232	missense	probably damaging	1.00
R0833:Dnah11	UTSW	12	118196662	missense	probably benign	0.01
R0835:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R0836:Dnah11	UTSW	12	118196662	missense	probably benign	0.01
R0846:Dnah11	UTSW	12	117933850	missense	probably damaging	0.97
R0865:Dnah11	UTSW	12	118190844	nonsense	probably null
R0928:Dnah11	UTSW	12	118045562	missense	probably damaging	1.00
R0939:Dnah11	UTSW	12	118060407	missense	probably damaging	1.00
R1203:Dnah11	UTSW	12	117933812	missense	possibly damaging	0.81
R1394:Dnah11	UTSW	12	117972364	missense	possibly damaging	0.75
R1398:Dnah11	UTSW	12	118057106	nonsense	probably null
R1465:Dnah11	UTSW	12	118038695	missense	probably damaging	1.00
R1465:Dnah11	UTSW	12	118038695	missense	probably damaging	1.00
R1500:Dnah11	UTSW	12	118012829	splice site	probably null
R1535:Dnah11	UTSW	12	118018730	missense	probably damaging	1.00
R1539:Dnah11	UTSW	12	117931256	missense	probably benign	0.01
R1554:Dnah11	UTSW	12	118082499	missense	possibly damaging	0.92
R1574:Dnah11	UTSW	12	118060317	missense	probably damaging	1.00
R1574:Dnah11	UTSW	12	118060317	missense	probably damaging	1.00
R1615:Dnah11	UTSW	12	118050722	missense	probably damaging	1.00
R1618:Dnah11	UTSW	12	118015465	missense	probably damaging	0.98
R1638:Dnah11	UTSW	12	118015419	missense	possibly damaging	0.81
R1659:Dnah11	UTSW	12	118120724	missense	possibly damaging	0.94
R1671:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1678:Dnah11	UTSW	12	117933845	missense	possibly damaging	0.50
R1699:Dnah11	UTSW	12	118190868	missense	probably damaging	1.00
R1712:Dnah11	UTSW	12	118196644	missense	probably benign	0.32
R1728:Dnah11	UTSW	12	117916931	missense	probably damaging	1.00
R1729:Dnah11	UTSW	12	117916931	missense	probably damaging	1.00
R1764:Dnah11	UTSW	12	118190825	missense	probably benign	0.31
R1780:Dnah11	UTSW	12	118027558	missense	probably damaging	1.00
R1789:Dnah11	UTSW	12	118038780	missense	probably damaging	0.99
R1800:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1863:Dnah11	UTSW	12	118063852	missense	possibly damaging	0.92
R1892:Dnah11	UTSW	12	118106474	missense	possibly damaging	0.53
R1907:Dnah11	UTSW	12	118127556	missense	possibly damaging	0.66
R1964:Dnah11	UTSW	12	118142292	missense	possibly damaging	0.56
R1967:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1997:Dnah11	UTSW	12	118082468	missense	possibly damaging	0.64
R2086:Dnah11	UTSW	12	118113871	missense	possibly damaging	0.82
R2092:Dnah11	UTSW	12	118012716	missense	possibly damaging	0.50
R2108:Dnah11	UTSW	12	118020353	missense	probably damaging	1.00
R2140:Dnah11	UTSW	12	118008810	missense	probably benign	0.01
R2261:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2261:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2262:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2262:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2263:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2263:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2328:Dnah11	UTSW	12	117886686	missense	probably damaging	0.98
R2352:Dnah11	UTSW	12	117928330	missense	probably damaging	1.00
R2410:Dnah11	UTSW	12	118027527	missense	probably damaging	1.00
R2885:Dnah11	UTSW	12	117987427	nonsense	probably null
R3499:Dnah11	UTSW	12	117911023	missense	probably damaging	1.00
R3741:Dnah11	UTSW	12	118131341	missense	probably benign	0.05
R3742:Dnah11	UTSW	12	118131341	missense	probably benign	0.05
R3779:Dnah11	UTSW	12	118130713	splice site	probably benign
R3785:Dnah11	UTSW	12	118017602	missense	probably damaging	1.00
R3883:Dnah11	UTSW	12	117978453	splice site	probably benign
R4014:Dnah11	UTSW	12	117974914	missense	probably benign	0.16
R4043:Dnah11	UTSW	12	117879943	missense	probably damaging	1.00
R4072:Dnah11	UTSW	12	118106492	missense	probably damaging	1.00
R4073:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4074:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4076:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4201:Dnah11	UTSW	12	117966659	missense	possibly damaging	0.63
R4224:Dnah11	UTSW	12	118130892	missense	probably benign	0.06
R4233:Dnah11	UTSW	12	117916791	missense	probably damaging	1.00
R4358:Dnah11	UTSW	12	118125843	nonsense	probably null
R4430:Dnah11	UTSW	12	117983011	missense	probably benign	0.26
R4465:Dnah11	UTSW	12	117987451	missense	probably benign	0.09
R4489:Dnah11	UTSW	12	117916896	missense	probably benign	0.31
R4572:Dnah11	UTSW	12	118010125	missense	probably benign	0.00
R4574:Dnah11	UTSW	12	118012255	critical splice donor site	probably null
R4657:Dnah11	UTSW	12	118192427	missense	probably benign	0.02
R4709:Dnah11	UTSW	12	118018760	missense	probably benign	0.26
R4740:Dnah11	UTSW	12	118120544	missense	probably benign	0.28
R4803:Dnah11	UTSW	12	118127608	missense	possibly damaging	0.50
R4896:Dnah11	UTSW	12	117995200	missense	probably damaging	1.00
R4908:Dnah11	UTSW	12	118126883	missense	probably benign	0.37
R5018:Dnah11	UTSW	12	118130728	missense	probably benign	0.00
R5071:Dnah11	UTSW	12	118082453	nonsense	probably null
R5074:Dnah11	UTSW	12	118082453	nonsense	probably null
R5080:Dnah11	UTSW	12	118198830	start codon destroyed	probably null	0.01
R5097:Dnah11	UTSW	12	118017700	missense	probably damaging	1.00
R5131:Dnah11	UTSW	12	117954751	missense	probably damaging	1.00
R5215:Dnah11	UTSW	12	118157361	missense	probably benign	0.09
R5252:Dnah11	UTSW	12	118125941	missense	probably damaging	1.00
R5296:Dnah11	UTSW	12	117883416	missense	probably damaging	1.00
R5308:Dnah11	UTSW	12	118085680	missense	possibly damaging	0.60
R5368:Dnah11	UTSW	12	117954893	missense	probably damaging	1.00
R5383:Dnah11	UTSW	12	118085697	missense	probably damaging	0.99
R5499:Dnah11	UTSW	12	118106474	missense	possibly damaging	0.53
R5503:Dnah11	UTSW	12	117880451	critical splice donor site	probably null
R5546:Dnah11	UTSW	12	117975848	missense	possibly damaging	0.83
R5578:Dnah11	UTSW	12	118018802	missense	probably damaging	0.99
R5657:Dnah11	UTSW	12	117883617	missense	probably damaging	1.00
R5702:Dnah11	UTSW	12	118113907	missense	probably benign	0.04
R5706:Dnah11	UTSW	12	118023935	missense	probably damaging	1.00
R5727:Dnah11	UTSW	12	118127106	missense	probably damaging	1.00
R5737:Dnah11	UTSW	12	118192390	missense	probably benign
R5884:Dnah11	UTSW	12	118177534	missense	probably benign	0.00
R5900:Dnah11	UTSW	12	118082431	splice site	probably null
R5905:Dnah11	UTSW	12	117954924	missense	probably damaging	1.00
R5928:Dnah11	UTSW	12	117914636	splice site	probably null
R5973:Dnah11	UTSW	12	118110952	missense	probably benign	0.02
R6024:Dnah11	UTSW	12	118030272	missense	probably benign	0.34
R6056:Dnah11	UTSW	12	117928456	missense	probably benign	0.03
R6075:Dnah11	UTSW	12	118104851	missense	probably damaging	1.00
R6092:Dnah11	UTSW	12	117928456	missense	probably benign
R6191:Dnah11	UTSW	12	118190897	missense	probably benign
R6197:Dnah11	UTSW	12	118179747	missense	probably benign	0.03
R6262:Dnah11	UTSW	12	117931178	missense	probably damaging	0.98
R6321:Dnah11	UTSW	12	118142292	missense	possibly damaging	0.56
R6454:Dnah11	UTSW	12	117916855	missense	probably benign	0.01
R6614:Dnah11	UTSW	12	117886676	missense	possibly damaging	0.72
R6694:Dnah11	UTSW	12	118186882	splice site	probably null
R6712:Dnah11	UTSW	12	118050722	missense	probably damaging	1.00
R6720:Dnah11	UTSW	12	118045646	missense	probably damaging	1.00
R6742:Dnah11	UTSW	12	118113894	missense	possibly damaging	0.82
R6806:Dnah11	UTSW	12	117987676	splice site	probably null
R6895:Dnah11	UTSW	12	117995191	missense	probably damaging	0.99
R6939:Dnah11	UTSW	12	118106562	missense	probably damaging	1.00
R6940:Dnah11	UTSW	12	118198768	missense	probably benign
R6945:Dnah11	UTSW	12	118060310	missense	probably damaging	1.00
R6958:Dnah11	UTSW	12	117933809	missense	probably damaging	1.00
R6970:Dnah11	UTSW	12	118108944	missense	probably benign	0.00
R6976:Dnah11	UTSW	12	118198643	missense	probably benign	0.16
R7000:Dnah11	UTSW	12	118017661	missense	probably damaging	1.00
R7011:Dnah11	UTSW	12	117922018	frame shift	probably null
R7101:Dnah11	UTSW	12	118068145	missense	probably benign
R7106:Dnah11	UTSW	12	117961149	missense	probably benign	0.15
R7219:Dnah11	UTSW	12	118041095	missense	possibly damaging	0.95
R7219:Dnah11	UTSW	12	118126889	missense	probably benign	0.00
R7308:Dnah11	UTSW	12	117995275	missense	probably damaging	1.00
R7361:Dnah11	UTSW	12	118018742	missense	probably damaging	1.00
R7367:Dnah11	UTSW	12	117987442	missense	possibly damaging	0.59
R7399:Dnah11	UTSW	12	118027477	missense	probably benign	0.00
R7399:Dnah11	UTSW	12	118125785	missense	probably damaging	1.00
R7404:Dnah11	UTSW	12	118104808	missense	probably benign	0.36
R7473:Dnah11	UTSW	12	117903176	missense	probably benign	0.19
R7545:Dnah11	UTSW	12	117931204	missense	probably damaging	1.00
R7608:Dnah11	UTSW	12	118140770	splice site	probably null
R7625:Dnah11	UTSW	12	118196642	missense	probably benign
R7761:Dnah11	UTSW	12	118023913	missense	probably damaging	1.00
R7879:Dnah11	UTSW	12	118041009	missense	probably damaging	1.00
R7881:Dnah11	UTSW	12	117987502	missense	probably benign	0.04
R7904:Dnah11	UTSW	12	117903268	missense	possibly damaging	0.72
R8100:Dnah11	UTSW	12	117966633	missense	probably damaging	0.99
R8179:Dnah11	UTSW	12	117878549	missense	possibly damaging	0.90
R8192:Dnah11	UTSW	12	118012446	missense	probably benign
R8254:Dnah11	UTSW	12	117878524	missense	possibly damaging	0.89
R8268:Dnah11	UTSW	12	118027508	nonsense	probably null
R8272:Dnah11	UTSW	12	118111017	missense	probably benign	0.01
R8344:Dnah11	UTSW	12	118085731	missense	probably benign	0.00
R8515:Dnah11	UTSW	12	117975798	missense	probably damaging	1.00
R8528:Dnah11	UTSW	12	118008803	missense	probably damaging	0.96
R8557:Dnah11	UTSW	12	117878512	missense	probably benign
R8676:Dnah11	UTSW	12	118190804	missense	probably damaging	1.00
R8738:Dnah11	UTSW	12	118085649	critical splice donor site	probably null
R8773:Dnah11	UTSW	12	117995215	missense	possibly damaging	0.94
R8818:Dnah11	UTSW	12	117911029	missense	probably damaging	1.00
R8855:Dnah11	UTSW	12	118192372	missense	probably benign	0.03
R8866:Dnah11	UTSW	12	118192372	missense	probably benign	0.03
R8881:Dnah11	UTSW	12	118113912	missense	probably benign	0.00
R8881:Dnah11	UTSW	12	118126815	missense	probably benign	0.05
R8920:Dnah11	UTSW	12	118113939	missense	probably damaging	0.99
R8944:Dnah11	UTSW	12	118127646	missense	possibly damaging	0.63
R8945:Dnah11	UTSW	12	118023983	missense	probably benign	0.36
R8962:Dnah11	UTSW	12	117952538	missense	probably damaging	1.00
R8962:Dnah11	UTSW	12	117954895	missense	probably damaging	1.00
R9059:Dnah11	UTSW	12	118130843	missense	probably benign	0.00
R9155:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9162:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9164:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9171:Dnah11	UTSW	12	117931183	missense	probably damaging	0.99
R9186:Dnah11	UTSW	12	118190897	missense	probably benign
R9205:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9208:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9234:Dnah11	UTSW	12	117987360	missense	probably damaging	1.00
R9264:Dnah11	UTSW	12	118027527	missense	probably damaging	1.00
R9290:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9291:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9315:Dnah11	UTSW	12	118179606	missense	probably benign	0.11
R9353:Dnah11	UTSW	12	118179699	missense	probably benign	0.00
R9375:Dnah11	UTSW	12	117920968	missense	possibly damaging	0.67
R9392:Dnah11	UTSW	12	118047320	nonsense	probably null
R9392:Dnah11	UTSW	12	118177555	missense	probably benign	0.00
R9433:Dnah11	UTSW	12	118012272	missense	probably damaging	1.00
R9511:Dnah11	UTSW	12	117914617	missense	probably damaging	1.00
R9526:Dnah11	UTSW	12	118186976	missense	probably damaging	0.98
R9566:Dnah11	UTSW	12	117974993	missense	possibly damaging	0.69
R9673:Dnah11	UTSW	12	118018778	missense	possibly damaging	0.91
R9705:Dnah11	UTSW	12	118131035	missense	probably damaging	1.00
R9716:Dnah11	UTSW	12	118060413	missense	probably damaging	0.99
R9746:Dnah11	UTSW	12	117878576	nonsense	probably null
R9764:Dnah11	UTSW	12	117920969	missense	probably benign	0.05
RF023:Dnah11	UTSW	12	117954850	missense	probably damaging	1.00
RF047:Dnah11	UTSW	12	118010083	missense	probably damaging	1.00
Z1088:Dnah11	UTSW	12	117895012	missense	probably damaging	1.00
Z1088:Dnah11	UTSW	12	117982969	missense	probably damaging	1.00
Z1176:Dnah11	UTSW	12	117931177	missense	possibly damaging	0.81
Z1176:Dnah11	UTSW	12	118127119	missense	probably benign	0.00
Z1176:Dnah11	UTSW	12	118130799	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGGCACATGTAACCCAGAAG -3'
(R):5'- AGCATTGAGGGACTTTAATATGCC -3'

Sequencing Primer
(F):5'- TTGAAGATCTCCTTGATAGAGACTAG -3'
(R):5'- GCCTAAAATTGTAACTGATGATGTCC -3'

Posted On

2019-06-26