Mutagenetix > Incidental Mutations

Incidental Mutation 'R7203:Dock8'

560837

Institutional Source

Beutler Lab

Gene Symbol

Dock8

Ensembl Gene

ENSMUSG00000052085

Gene Name

dedicator of cytokinesis 8

Synonyms

A130095G14Rik, 5830472H07Rik, 1200017A24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R7203 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24999529-25202432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25181563 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 1695 (N1695I)

Ref Sequence

ENSEMBL: ENSMUSP00000025831 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025831]

AlphaFold

Q8C147

PDB Structure

Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025831
AA Change: N1695I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: N1695I

Domain	Start	End	E-Value	Type
Pfam:DUF3398	71	164	3.9e-25	PFAM
Pfam:DOCK-C2	557	739	6.7e-49	PFAM
low complexity region	786	803	N/A	INTRINSIC
low complexity region	1003	1020	N/A	INTRINSIC
low complexity region	1123	1138	N/A	INTRINSIC
low complexity region	1236	1246	N/A	INTRINSIC
low complexity region	1371	1383	N/A	INTRINSIC
Pfam:DHR-2	1534	2060	5e-210	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (108/108)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544G11Rik	T	C	6: 65,953,333	V184A	probably benign	Het
4932415D10Rik	G	A	10: 82,293,414	T1254I	probably benign	Het
Aars2	A	G	17: 45,516,571	Y513C	probably damaging	Het
Ackr2	G	A	9: 121,908,967	C136Y	probably damaging	Het
Aldh1l1	A	G	6: 90,570,800	K414R	probably benign	Het
Arl9	A	G	5: 77,007,271	Y83C	possibly damaging	Het
Atp10a	G	T	7: 58,786,473	R337L	probably benign	Het
Atp6v1g3	A	T	1: 138,287,800	Q66L	probably damaging	Het
Atp7b	A	T	8: 21,997,335	N1321K	probably damaging	Het
Axdnd1	A	T	1: 156,382,389	M437K	probably damaging	Het
Bap1	C	A	14: 31,254,169	P147Q	probably damaging	Het
Bicd1	C	T	6: 149,512,905	T372I	possibly damaging	Het
Brix1	T	C	15: 10,483,292		probably null	Het
Btrc	A	G	19: 45,513,528		probably null	Het
C130050O18Rik	A	C	5: 139,414,374	I61L	probably benign	Het
Cfap161	A	G	7: 83,776,050	S278P	probably damaging	Het
Cgnl1	T	C	9: 71,724,533	D512G	possibly damaging	Het
Chat	T	C	14: 32,419,057	D461G	probably damaging	Het
Chl1	T	A	6: 103,691,674	V456D	probably benign	Het
Cib1	T	C	7: 80,232,372	T20A	possibly damaging	Het
Cubn	T	G	2: 13,351,003	H1806P	probably benign	Het
Dapk1	T	A	13: 60,696,335	V56E	possibly damaging	Het
Dennd4a	A	G	9: 64,896,474	N1032D	probably benign	Het
Dlg5	T	A	14: 24,138,655	E1756V	probably damaging	Het
Dnah1	T	C	14: 31,274,382	T2666A	probably benign	Het
Dnah11	A	T	12: 118,045,522	I2135N	possibly damaging	Het
Dnah6	T	A	6: 73,173,545	E745V	probably benign	Het
Esf1	C	T	2: 140,164,219	R336Q	possibly damaging	Het
Fam161a	A	G	11: 23,021,664		probably null	Het
Fam89a	T	C	8: 124,751,679	E44G	possibly damaging	Het
Fndc3b	A	T	3: 27,456,485	D829E	probably benign	Het
Fxr1	C	T	3: 34,046,540	T125I	possibly damaging	Het
Gfer	T	C	17: 24,695,862	D69G	probably damaging	Het
Gm16486	A	T	8: 70,716,948	E1229V	probably benign	Het
Gm2000	A	T	1: 156,366,087	I4F	probably damaging	Het
Gpatch2l	T	A	12: 86,288,937	S471T	probably benign	Het
Grm7	T	G	6: 111,358,569	I647S	possibly damaging	Het
Gsn	A	G	2: 35,298,795	I447V	probably benign	Het
H2al2c	C	T	Y: 2,599,234	L46F	possibly damaging	Het
Hao2	A	C	3: 98,877,282		probably null	Het
Ifitm10	T	C	7: 142,328,568	E155G	probably benign	Het
Igkv8-16	C	A	6: 70,386,810	W76L	probably benign	Het
Igsf21	A	T	4: 140,107,337	F75I	possibly damaging	Het
Ints14	T	A	9: 64,964,419	M13K	probably damaging	Het
Ipmk	A	T	10: 71,363,468	D53V	possibly damaging	Het
Itga8	A	G	2: 12,230,095	F451L	possibly damaging	Het
Jup	A	G	11: 100,381,734	F284S	probably damaging	Het
Kctd5	T	C	17: 24,073,235	D65G	probably benign	Het
Klrc1	A	T	6: 129,677,221	S148T	probably benign	Het
Kmt5b	A	G	19: 3,814,147	K404E	probably damaging	Het
Krt9	A	C	11: 100,190,791	M304R	probably damaging	Het
Krtap5-1	A	T	7: 142,296,562	S143T	unknown	Het
Kyat3	A	G	3: 142,720,401	N68D	probably damaging	Het
Kynu	A	G	2: 43,681,353	D427G	probably damaging	Het
Leo1	A	G	9: 75,445,996		probably null	Het
Loxhd1	A	G	18: 77,414,196	D1737G	probably damaging	Het
Lpo	C	A	11: 87,809,251	L521F	possibly damaging	Het
Lrrk1	A	G	7: 66,270,825	S1477P	probably damaging	Het
Lrrtm1	C	A	6: 77,243,601	L14M	probably damaging	Het
Ly75	G	A	2: 60,323,852	R1084*	probably null	Het
Mcf2l	A	G	8: 13,010,456	D764G	probably benign	Het
Mrgprd	A	T	7: 145,322,349	D319V	probably benign	Het
Mut	A	T	17: 40,938,673	M180L	probably benign	Het
Myom3	T	C	4: 135,795,179	L897P	possibly damaging	Het
Ncapd2	A	T	6: 125,184,328	M247K	possibly damaging	Het
Nlrp2	T	C	7: 5,317,534	D868G	probably damaging	Het
Npy6r	A	G	18: 44,275,932	N140S	probably damaging	Het
Nsmce4a	T	C	7: 130,539,872	K196E	probably benign	Het
Nup88	T	C	11: 70,945,254	K532R	probably benign	Het
Olfr424	T	A	1: 174,137,114	Y123*	probably null	Het
Olfr947-ps1	A	T	9: 39,289,293	I199N	unknown	Het
Olfr974	T	A	9: 39,942,509	V83E	probably benign	Het
Pbxip1	A	T	3: 89,447,428	D418V	possibly damaging	Het
Pde2a	C	A	7: 101,509,944	R761S	possibly damaging	Het
Phf10	A	T	17: 14,946,313	C432S	probably damaging	Het
Pitpnm2	T	C	5: 124,121,459	D1271G	probably damaging	Het
Plin1	A	T	7: 79,723,444	L259Q	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Pou6f2	T	A	13: 18,239,794	Q132L	unknown	Het
Ppa2	A	T	3: 133,330,438	N118Y	possibly damaging	Het
Prickle2	T	C	6: 92,410,978	E537G	possibly damaging	Het
Prl3d1	A	G	13: 27,098,701	I141V	possibly damaging	Het
Prl8a1	A	T	13: 27,574,189	V179D	probably damaging	Het
Prr14l	A	G	5: 32,827,145	F1669L	probably benign	Het
Prrg4	T	A	2: 104,839,442	E110V	possibly damaging	Het
Rfx5	C	A	3: 94,958,876	H495Q	unknown	Het
Rgl2	C	T	17: 33,933,429	R367W	probably damaging	Het
Rpe65	A	G	3: 159,622,854	Y433C	probably damaging	Het
Rtn4rl1	C	T	11: 75,265,750	S336F	possibly damaging	Het
Scn2a	A	G	2: 65,748,319	D1446G	probably benign	Het
Sdk1	C	A	5: 142,046,176	T1002K	probably benign	Het
Slc9b2	T	C	3: 135,330,661	S409P	probably benign	Het
Sowahc	A	G	10: 59,222,278	T79A	probably benign	Het
Stk35	T	A	2: 129,801,593	C166S	probably benign	Het
Tarbp2	A	G	15: 102,522,487	H225R	probably benign	Het
Tdrd12	T	A	7: 35,489,223	K530*	probably null	Het
Terf2ip	A	G	8: 112,017,986	I312V	probably benign	Het
Tgfb1	T	C	7: 25,692,539		probably null	Het
Thbs2	T	C	17: 14,671,458	D939G	probably damaging	Het
Ube4b	A	T	4: 149,398,610	I67K	probably benign	Het
Ubn1	G	T	16: 5,077,216	V709F	possibly damaging	Het
Ugt2b5	T	C	5: 87,128,399	K339E	possibly damaging	Het
Vax2	T	C	6: 83,737,900	S266P	probably damaging	Het
Vmn2r108	A	G	17: 20,462,776	I722T	probably benign	Het
Vmn2r95	A	G	17: 18,441,315	K441R	probably benign	Het
Wapl	C	A	14: 34,736,691	D903E	probably benign	Het
Wee1	T	A	7: 110,134,794	V442D	probably benign	Het
Zan	T	C	5: 137,434,096	N2313S	unknown	Het

Other mutations in Dock8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
captain_morgan	APN	19	25127711	critical splice donor site	probably benign
primurus	APN	19	25183609	missense	probably damaging	1.00
IGL00737:Dock8	APN	19	25182976	missense	probably benign	0.00
IGL00755:Dock8	APN	19	25051509	missense	probably benign	0.09
IGL00822:Dock8	APN	19	25188409	nonsense	probably null
IGL00838:Dock8	APN	19	25175459	nonsense	probably null
IGL01419:Dock8	APN	19	25119452	missense	probably benign	0.08
IGL01456:Dock8	APN	19	25119499	missense	possibly damaging	0.95
IGL01532:Dock8	APN	19	25169441	missense	probably damaging	0.99
IGL01602:Dock8	APN	19	25089888	splice site	probably benign
IGL01605:Dock8	APN	19	25089888	splice site	probably benign
IGL01753:Dock8	APN	19	25061292	splice site	probably benign
IGL01843:Dock8	APN	19	25089928	missense	probably benign	0.02
IGL02032:Dock8	APN	19	25130405	missense	probably damaging	0.99
IGL02073:Dock8	APN	19	25200986	critical splice acceptor site	probably null
IGL02192:Dock8	APN	19	25078205	critical splice donor site	probably null
IGL02402:Dock8	APN	19	25078145	missense	probably benign	0.25
IGL02529:Dock8	APN	19	25100926	nonsense	probably null
IGL02728:Dock8	APN	19	25132220	missense	probably benign
IGL02739:Dock8	APN	19	25188488	missense	probably damaging	1.00
IGL03037:Dock8	APN	19	25086181	missense	probably benign	0.02
IGL03104:Dock8	APN	19	25201020	nonsense	probably null
IGL03137:Dock8	APN	19	25155948	missense	probably benign	0.19
IGL03365:Dock8	APN	19	25099684	missense	possibly damaging	0.70
Defenseless	UTSW	19	25051563	missense	probably benign	0.00
Guardate	UTSW	19	25149831	missense	probably benign
hillock	UTSW	19	25174333	critical splice donor site	probably null
Molehill	UTSW	19	25130461	missense	probably damaging	1.00
Pap	UTSW	19	25122441	missense	probably benign	0.31
Papilla	UTSW	19	25078084	nonsense	probably null
snowdrop	UTSW	19	25184941	critical splice donor site	probably null
warts_and_all	UTSW	19	25169501	critical splice donor site	probably null
R0021:Dock8	UTSW	19	25163047	missense	probably benign	0.01
R0147:Dock8	UTSW	19	25119459	missense	probably benign	0.00
R0148:Dock8	UTSW	19	25119459	missense	probably benign	0.00
R0294:Dock8	UTSW	19	25188350	missense	probably damaging	1.00
R0537:Dock8	UTSW	19	25171577	missense	probably benign	0.08
R0630:Dock8	UTSW	19	25061160	missense	probably benign	0.10
R1163:Dock8	UTSW	19	25051503	missense	probably benign
R1164:Dock8	UTSW	19	25090027	missense	probably benign	0.44
R1471:Dock8	UTSW	19	25201036	missense	possibly damaging	0.74
R1477:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R1633:Dock8	UTSW	19	25051563	missense	probably benign	0.00
R1803:Dock8	UTSW	19	25132235	missense	probably benign	0.00
R1822:Dock8	UTSW	19	25161058	missense	probably benign	0.31
R1852:Dock8	UTSW	19	25127128	missense	probably benign	0.45
R1916:Dock8	UTSW	19	25061157	missense	probably benign	0.02
R1984:Dock8	UTSW	19	25121181	missense	probably null	0.95
R2311:Dock8	UTSW	19	25183004	missense	possibly damaging	0.93
R2341:Dock8	UTSW	19	25200393	missense	probably damaging	0.99
R2483:Dock8	UTSW	19	25079877	missense	probably benign
R3116:Dock8	UTSW	19	25188494	missense	probably benign	0.00
R3157:Dock8	UTSW	19	25149831	missense	probably benign
R3623:Dock8	UTSW	19	25079877	missense	probably benign
R3624:Dock8	UTSW	19	25079877	missense	probably benign
R3800:Dock8	UTSW	19	25164352	missense	probably benign	0.08
R3844:Dock8	UTSW	19	25065430	nonsense	probably null
R3895:Dock8	UTSW	19	25051501	missense	probably benign	0.31
R3901:Dock8	UTSW	19	25100905	missense	possibly damaging	0.69
R3959:Dock8	UTSW	19	25184941	critical splice donor site	probably null
R4428:Dock8	UTSW	19	25200499	missense	probably damaging	0.98
R4428:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4429:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4431:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4545:Dock8	UTSW	19	25188358	missense	probably damaging	1.00
R4839:Dock8	UTSW	19	25169494	missense	probably benign	0.00
R4897:Dock8	UTSW	19	25181637	missense	probably benign	0.00
R4939:Dock8	UTSW	19	25122400	missense	probably damaging	1.00
R4995:Dock8	UTSW	19	25158383	missense	probably benign	0.02
R5035:Dock8	UTSW	19	25086207	missense	probably damaging	0.99
R5294:Dock8	UTSW	19	25061153	missense	probably benign	0.01
R5324:Dock8	UTSW	19	25163094	missense	probably benign	0.17
R5478:Dock8	UTSW	19	25079822	missense	probably benign
R5704:Dock8	UTSW	19	25174222	missense	probably damaging	1.00
R5724:Dock8	UTSW	19	25122421	missense	probably damaging	1.00
R5745:Dock8	UTSW	19	25130397	missense	probably benign	0.02
R5864:Dock8	UTSW	19	25061220	missense	probably damaging	0.99
R5870:Dock8	UTSW	19	25132126	missense	probably benign
R5893:Dock8	UTSW	19	25122447	missense	probably damaging	1.00
R5954:Dock8	UTSW	19	25171619	missense	probably damaging	1.00
R6087:Dock8	UTSW	19	25161074	missense	probably benign	0.00
R6223:Dock8	UTSW	19	25161052	missense	probably benign	0.00
R6391:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R6759:Dock8	UTSW	19	25127484	missense	probably damaging	0.99
R6786:Dock8	UTSW	19	25183022	missense	possibly damaging	0.49
R6794:Dock8	UTSW	19	25122441	missense	probably benign	0.31
R6818:Dock8	UTSW	19	25169501	critical splice donor site	probably null
R6885:Dock8	UTSW	19	25147378	missense	possibly damaging	0.95
R6908:Dock8	UTSW	19	25188382	missense	probably damaging	1.00
R6923:Dock8	UTSW	19	25095606	missense	probably benign
R7001:Dock8	UTSW	19	25099677	missense	probably benign
R7141:Dock8	UTSW	19	25181620	missense	probably null	0.75
R7257:Dock8	UTSW	19	25127085	missense	probably benign	0.08
R7296:Dock8	UTSW	19	25184881	missense	probably benign	0.00
R7538:Dock8	UTSW	19	25158418	missense	probably damaging	1.00
R7555:Dock8	UTSW	19	25175400	missense	probably damaging	0.99
R7641:Dock8	UTSW	19	25174333	critical splice donor site	probably null
R7764:Dock8	UTSW	19	25097535	missense	probably benign
R7859:Dock8	UTSW	19	25183570	missense	probably damaging	1.00
R7864:Dock8	UTSW	19	25163500	missense	possibly damaging	0.95
R8090:Dock8	UTSW	19	25154242	missense	probably damaging	1.00
R8160:Dock8	UTSW	19	25147347	missense	probably damaging	1.00
R8287:Dock8	UTSW	19	25130461	missense	probably damaging	1.00
R8295:Dock8	UTSW	19	25123236	missense	probably benign	0.04
R8443:Dock8	UTSW	19	25155917	missense	probably benign	0.04
R8537:Dock8	UTSW	19	25130506	missense	probably benign	0.00
R8673:Dock8	UTSW	19	25183503	missense	probably damaging	0.96
R8709:Dock8	UTSW	19	25078084	nonsense	probably null
R8834:Dock8	UTSW	19	25163470	missense	probably benign	0.16
R8991:Dock8	UTSW	19	25188367	missense	possibly damaging	0.82
X0027:Dock8	UTSW	19	25161129	missense	probably benign
Z1177:Dock8	UTSW	19	25132123	missense	probably benign	0.05
Z1177:Dock8	UTSW	19	25155972	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- AGTTTCAAAATGAATGGCCACC -3'
(R):5'- AATTGTGGACATGGACGTCTCC -3'

Sequencing Primer
(F):5'- CACCAGAAGCTCACAGGTTGG -3'
(R):5'- GGACGTCTCCACTGGACCAATC -3'

Posted On

2019-06-26