Incidental Mutation 'R7203:Dock8'
ID 560837
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms A130095G14Rik, 5830472H07Rik, 1200017A24Rik
MMRRC Submission 045281-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R7203 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 24999529-25202432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25181563 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 1695 (N1695I)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000025831
AA Change: N1695I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: N1695I

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (108/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,953,333 V184A probably benign Het
4932415D10Rik G A 10: 82,293,414 T1254I probably benign Het
Aars2 A G 17: 45,516,571 Y513C probably damaging Het
Ackr2 G A 9: 121,908,967 C136Y probably damaging Het
Aldh1l1 A G 6: 90,570,800 K414R probably benign Het
Arl9 A G 5: 77,007,271 Y83C possibly damaging Het
Atp10a G T 7: 58,786,473 R337L probably benign Het
Atp6v1g3 A T 1: 138,287,800 Q66L probably damaging Het
Atp7b A T 8: 21,997,335 N1321K probably damaging Het
Axdnd1 A T 1: 156,382,389 M437K probably damaging Het
Bap1 C A 14: 31,254,169 P147Q probably damaging Het
Bicd1 C T 6: 149,512,905 T372I possibly damaging Het
Brix1 T C 15: 10,483,292 probably null Het
Btrc A G 19: 45,513,528 probably null Het
C130050O18Rik A C 5: 139,414,374 I61L probably benign Het
Cfap161 A G 7: 83,776,050 S278P probably damaging Het
Cgnl1 T C 9: 71,724,533 D512G possibly damaging Het
Chat T C 14: 32,419,057 D461G probably damaging Het
Chl1 T A 6: 103,691,674 V456D probably benign Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Cubn T G 2: 13,351,003 H1806P probably benign Het
Dapk1 T A 13: 60,696,335 V56E possibly damaging Het
Dennd4a A G 9: 64,896,474 N1032D probably benign Het
Dlg5 T A 14: 24,138,655 E1756V probably damaging Het
Dnah1 T C 14: 31,274,382 T2666A probably benign Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah6 T A 6: 73,173,545 E745V probably benign Het
Esf1 C T 2: 140,164,219 R336Q possibly damaging Het
Fam161a A G 11: 23,021,664 probably null Het
Fam89a T C 8: 124,751,679 E44G possibly damaging Het
Fndc3b A T 3: 27,456,485 D829E probably benign Het
Fxr1 C T 3: 34,046,540 T125I possibly damaging Het
Gfer T C 17: 24,695,862 D69G probably damaging Het
Gm16486 A T 8: 70,716,948 E1229V probably benign Het
Gm2000 A T 1: 156,366,087 I4F probably damaging Het
Gpatch2l T A 12: 86,288,937 S471T probably benign Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gsn A G 2: 35,298,795 I447V probably benign Het
H2al2c C T Y: 2,599,234 L46F possibly damaging Het
Hao2 A C 3: 98,877,282 probably null Het
Ifitm10 T C 7: 142,328,568 E155G probably benign Het
Igkv8-16 C A 6: 70,386,810 W76L probably benign Het
Igsf21 A T 4: 140,107,337 F75I possibly damaging Het
Ints14 T A 9: 64,964,419 M13K probably damaging Het
Ipmk A T 10: 71,363,468 D53V possibly damaging Het
Itga8 A G 2: 12,230,095 F451L possibly damaging Het
Jup A G 11: 100,381,734 F284S probably damaging Het
Kctd5 T C 17: 24,073,235 D65G probably benign Het
Klrc1 A T 6: 129,677,221 S148T probably benign Het
Kmt5b A G 19: 3,814,147 K404E probably damaging Het
Krt9 A C 11: 100,190,791 M304R probably damaging Het
Krtap5-1 A T 7: 142,296,562 S143T unknown Het
Kyat3 A G 3: 142,720,401 N68D probably damaging Het
Kynu A G 2: 43,681,353 D427G probably damaging Het
Leo1 A G 9: 75,445,996 probably null Het
Loxhd1 A G 18: 77,414,196 D1737G probably damaging Het
Lpo C A 11: 87,809,251 L521F possibly damaging Het
Lrrk1 A G 7: 66,270,825 S1477P probably damaging Het
Lrrtm1 C A 6: 77,243,601 L14M probably damaging Het
Ly75 G A 2: 60,323,852 R1084* probably null Het
Mcf2l A G 8: 13,010,456 D764G probably benign Het
Mrgprd A T 7: 145,322,349 D319V probably benign Het
Mut A T 17: 40,938,673 M180L probably benign Het
Myom3 T C 4: 135,795,179 L897P possibly damaging Het
Ncapd2 A T 6: 125,184,328 M247K possibly damaging Het
Nlrp2 T C 7: 5,317,534 D868G probably damaging Het
Npy6r A G 18: 44,275,932 N140S probably damaging Het
Nsmce4a T C 7: 130,539,872 K196E probably benign Het
Nup88 T C 11: 70,945,254 K532R probably benign Het
Olfr424 T A 1: 174,137,114 Y123* probably null Het
Olfr947-ps1 A T 9: 39,289,293 I199N unknown Het
Olfr974 T A 9: 39,942,509 V83E probably benign Het
Pbxip1 A T 3: 89,447,428 D418V possibly damaging Het
Pde2a C A 7: 101,509,944 R761S possibly damaging Het
Phf10 A T 17: 14,946,313 C432S probably damaging Het
Pitpnm2 T C 5: 124,121,459 D1271G probably damaging Het
Plin1 A T 7: 79,723,444 L259Q probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pou6f2 T A 13: 18,239,794 Q132L unknown Het
Ppa2 A T 3: 133,330,438 N118Y possibly damaging Het
Prickle2 T C 6: 92,410,978 E537G possibly damaging Het
Prl3d1 A G 13: 27,098,701 I141V possibly damaging Het
Prl8a1 A T 13: 27,574,189 V179D probably damaging Het
Prr14l A G 5: 32,827,145 F1669L probably benign Het
Prrg4 T A 2: 104,839,442 E110V possibly damaging Het
Rfx5 C A 3: 94,958,876 H495Q unknown Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rpe65 A G 3: 159,622,854 Y433C probably damaging Het
Rtn4rl1 C T 11: 75,265,750 S336F possibly damaging Het
Scn2a A G 2: 65,748,319 D1446G probably benign Het
Sdk1 C A 5: 142,046,176 T1002K probably benign Het
Slc9b2 T C 3: 135,330,661 S409P probably benign Het
Sowahc A G 10: 59,222,278 T79A probably benign Het
Stk35 T A 2: 129,801,593 C166S probably benign Het
Tarbp2 A G 15: 102,522,487 H225R probably benign Het
Tdrd12 T A 7: 35,489,223 K530* probably null Het
Terf2ip A G 8: 112,017,986 I312V probably benign Het
Tgfb1 T C 7: 25,692,539 probably null Het
Thbs2 T C 17: 14,671,458 D939G probably damaging Het
Ube4b A T 4: 149,398,610 I67K probably benign Het
Ubn1 G T 16: 5,077,216 V709F possibly damaging Het
Ugt2b5 T C 5: 87,128,399 K339E possibly damaging Het
Vax2 T C 6: 83,737,900 S266P probably damaging Het
Vmn2r108 A G 17: 20,462,776 I722T probably benign Het
Vmn2r95 A G 17: 18,441,315 K441R probably benign Het
Wapl C A 14: 34,736,691 D903E probably benign Het
Wee1 T A 7: 110,134,794 V442D probably benign Het
Zan T C 5: 137,434,096 N2313S unknown Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127712 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
hillock UTSW 19 25174333 critical splice donor site probably null
Molehill UTSW 19 25130461 missense probably damaging 1.00
Pap UTSW 19 25122441 missense probably benign 0.31
Papilla UTSW 19 25078084 nonsense probably null
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7538:Dock8 UTSW 19 25158418 missense probably damaging 1.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
R7764:Dock8 UTSW 19 25097535 missense probably benign
R7859:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7864:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25154242 missense probably damaging 1.00
R8160:Dock8 UTSW 19 25147347 missense probably damaging 1.00
R8287:Dock8 UTSW 19 25130461 missense probably damaging 1.00
R8295:Dock8 UTSW 19 25123236 missense probably benign 0.04
R8443:Dock8 UTSW 19 25155917 missense probably benign 0.04
R8537:Dock8 UTSW 19 25130506 missense probably benign 0.00
R8673:Dock8 UTSW 19 25183503 missense probably damaging 0.96
R8709:Dock8 UTSW 19 25078084 nonsense probably null
R8834:Dock8 UTSW 19 25163470 missense probably benign 0.16
R8991:Dock8 UTSW 19 25188367 missense possibly damaging 0.82
R9292:Dock8 UTSW 19 25183631 splice site probably benign
R9509:Dock8 UTSW 19 25095621 missense probably benign 0.00
R9526:Dock8 UTSW 19 25188375 missense probably benign 0.10
R9622:Dock8 UTSW 19 25121181 missense probably null
R9634:Dock8 UTSW 19 25192221 missense probably damaging 1.00
R9654:Dock8 UTSW 19 25147346 missense probably damaging 1.00
R9670:Dock8 UTSW 19 25171562 missense probably null 0.01
R9699:Dock8 UTSW 19 25156024 critical splice donor site probably null
R9726:Dock8 UTSW 19 25177010 missense probably damaging 0.97
R9765:Dock8 UTSW 19 25169468 missense possibly damaging 0.94
X0027:Dock8 UTSW 19 25161129 missense probably benign
Z1177:Dock8 UTSW 19 25132123 missense probably benign 0.05
Z1177:Dock8 UTSW 19 25155972 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGTTTCAAAATGAATGGCCACC -3'
(R):5'- AATTGTGGACATGGACGTCTCC -3'

Sequencing Primer
(F):5'- CACCAGAAGCTCACAGGTTGG -3'
(R):5'- GGACGTCTCCACTGGACCAATC -3'
Posted On 2019-06-26