Incidental Mutation 'R7208:Vmn2r26'
ID560863
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Namevomeronasal 2, receptor 26
SynonymsV2r1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #R7208 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124024758-124062035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124061989 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 841 (I841T)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
Predicted Effect probably damaging
Transcript: ENSMUST00000032238
AA Change: I841T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: I841T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,308,645 probably null Het
Aass T C 6: 23,074,630 K854E probably damaging Het
Abcd2 G T 15: 91,190,682 Y309* probably null Het
Ache G A 5: 137,291,489 G360D probably damaging Het
Acot12 T C 13: 91,781,242 L396P probably benign Het
Acox2 T G 14: 8,241,303 D603A probably benign Het
Adam3 C A 8: 24,711,401 K245N probably damaging Het
Ankhd1 T C 18: 36,625,028 I925T probably benign Het
Arhgap27 C T 11: 103,360,759 V48M probably damaging Het
Atm A T 9: 53,512,008 probably null Het
B4galt4 T A 16: 38,753,940 F92Y probably damaging Het
Brwd1 C T 16: 96,035,959 R891Q probably damaging Het
Calcr T C 6: 3,687,612 Q462R probably benign Het
Ccdc112 T C 18: 46,287,631 R351G probably damaging Het
Ccdc80 T G 16: 45,096,710 S610A probably benign Het
Cdh20 C A 1: 104,954,071 N420K possibly damaging Het
Cntn3 G A 6: 102,278,422 R172* probably null Het
Ctnnd1 G T 2: 84,622,046 Q78K possibly damaging Het
D16Ertd472e A T 16: 78,575,926 L41H probably damaging Het
Dclk2 A T 3: 86,799,602 probably null Het
Dmwd C T 7: 19,080,309 H295Y probably benign Het
Dnaic2 T C 11: 114,757,162 V588A unknown Het
Dtx4 C T 19: 12,482,073 probably null Het
Dync2h1 C A 9: 7,141,059 D1323Y probably damaging Het
Fcgbp T A 7: 28,104,021 H1683Q probably benign Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Gm4070 A C 7: 105,902,179 S555R possibly damaging Het
Gm9195 A G 14: 72,451,752 S1876P possibly damaging Het
Grhl2 A C 15: 37,335,736 K431T probably damaging Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gtf2ird1 T C 5: 134,411,094 N94S probably benign Het
Hmgcs1 G T 13: 119,701,084 G195W probably damaging Het
Hrc A T 7: 45,336,565 Y380F possibly damaging Het
Kcnu1 C T 8: 25,919,637 Q863* probably null Het
Lemd2 G A 17: 27,196,191 P300L probably damaging Het
Lnpep A T 17: 17,552,910 Y665* probably null Het
Lrfn1 A G 7: 28,467,139 T653A probably benign Het
Ly6g6c A G 17: 35,067,411 T8A unknown Het
Mcm5 T C 8: 75,121,716 probably null Het
Med28 A T 5: 45,523,452 D86V probably damaging Het
Mup11 A G 4: 60,659,726 S171P possibly damaging Het
Nckap1 A G 2: 80,540,198 F383L probably benign Het
Nid1 G C 13: 13,468,385 G303R probably benign Het
Nkain3 A G 4: 20,282,892 V147A probably benign Het
Olfr361 A G 2: 37,085,658 V30A probably benign Het
Pde9a G A 17: 31,420,284 V63I possibly damaging Het
Pdlim2 T A 14: 70,174,377 I69F probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phf20l1 T C 15: 66,604,789 I245T probably benign Het
Prmt8 C T 6: 127,689,829 R394H possibly damaging Het
Prpf4b T A 13: 34,884,011 D274E unknown Het
Psmd6 A T 14: 14,112,225 probably null Het
Rgs16 T C 1: 153,741,670 L69P probably damaging Het
Robo3 A T 9: 37,424,724 I482N probably damaging Het
Scara3 C T 14: 65,931,266 V301I possibly damaging Het
Serpina1b T A 12: 103,728,294 H397L probably benign Het
Skint11 T A 4: 114,231,747 L246Q probably damaging Het
Skint5 T A 4: 113,539,339 R1212S unknown Het
Slc11a2 T C 15: 100,402,332 D348G probably benign Het
Slc15a2 T C 16: 36,756,281 K495E probably benign Het
Son T G 16: 91,662,102 D2072E unknown Het
Stau1 A G 2: 166,963,574 V34A probably damaging Het
Stk3 G T 15: 35,073,116 L153I possibly damaging Het
Swi5 A T 2: 32,287,910 V13E probably benign Het
Syne2 A T 12: 76,031,398 probably null Het
Synm T C 7: 67,734,915 M558V probably benign Het
Tep1 T A 14: 50,824,556 probably null Het
Tmc6 A G 11: 117,776,325 V149A probably benign Het
Tmem214 T A 5: 30,870,721 V95E possibly damaging Het
Tnnt2 T A 1: 135,850,376 probably null Het
Txlna A G 4: 129,631,278 probably null Het
Wasf2 G A 4: 133,195,734 V452I probably damaging Het
Wdr62 C T 7: 30,252,336 D673N probably damaging Het
Wdr78 T G 4: 103,066,352 I427L probably benign Het
Wdr95 C T 5: 149,595,371 T559I probably benign Het
Zbtb40 A T 4: 136,999,626 probably null Het
Zfat T C 15: 68,180,007 E646G probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R7914:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCCAGTCTCAGCTTGCTTATTG -3'
(R):5'- AGGTGATTAAGTTGCAGATGCC -3'

Sequencing Primer
(F):5'- GCTACCTGACAGCTTCAATGAGG -3'
(R):5'- AAGTTGCAGATGCCATTGTTTG -3'
Posted On2019-06-26