Incidental Mutation 'R7208:Vmn2r26'
ID 560863
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 045285-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7208 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124038948 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 841 (I841T)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably damaging
Transcript: ENSMUST00000032238
AA Change: I841T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: I841T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,629 (GRCm39) K854E probably damaging Het
Abcd2 G T 15: 91,074,885 (GRCm39) Y309* probably null Het
Ache G A 5: 137,289,751 (GRCm39) G360D probably damaging Het
Acot12 T C 13: 91,929,361 (GRCm39) L396P probably benign Het
Acox2 T G 14: 8,241,303 (GRCm38) D603A probably benign Het
Adam3 C A 8: 25,201,417 (GRCm39) K245N probably damaging Het
Ankhd1 T C 18: 36,758,081 (GRCm39) I925T probably benign Het
Arhgap27 C T 11: 103,251,585 (GRCm39) V48M probably damaging Het
Atm A T 9: 53,423,308 (GRCm39) probably null Het
B4galt4 T A 16: 38,574,302 (GRCm39) F92Y probably damaging Het
Brwd1 C T 16: 95,837,159 (GRCm39) R891Q probably damaging Het
Calcr T C 6: 3,687,612 (GRCm39) Q462R probably benign Het
Ccdc112 T C 18: 46,420,698 (GRCm39) R351G probably damaging Het
Ccdc80 T G 16: 44,917,073 (GRCm39) S610A probably benign Het
Cdh20 C A 1: 104,881,796 (GRCm39) N420K possibly damaging Het
Cntn3 G A 6: 102,255,383 (GRCm39) R172* probably null Het
Ctnnd1 G T 2: 84,452,390 (GRCm39) Q78K possibly damaging Het
D16Ertd472e A T 16: 78,372,814 (GRCm39) L41H probably damaging Het
Dclk2 A T 3: 86,706,909 (GRCm39) probably null Het
Dmwd C T 7: 18,814,234 (GRCm39) H295Y probably benign Het
Dnai2 T C 11: 114,647,988 (GRCm39) V588A unknown Het
Dnai4 T G 4: 102,923,549 (GRCm39) I427L probably benign Het
Dtx4 C T 19: 12,459,437 (GRCm39) probably null Het
Dync2h1 C A 9: 7,141,059 (GRCm39) D1323Y probably damaging Het
Fcgbp T A 7: 27,803,446 (GRCm39) H1683Q probably benign Het
Fndc3c1 G C X: 105,478,679 (GRCm39) L724V possibly damaging Het
Gm9195 A G 14: 72,689,192 (GRCm39) S1876P possibly damaging Het
Grhl2 A C 15: 37,335,980 (GRCm39) K431T probably damaging Het
Grm7 T G 6: 111,335,530 (GRCm39) I647S possibly damaging Het
Gtf2ird1 T C 5: 134,439,948 (GRCm39) N94S probably benign Het
Gvin2 A C 7: 105,551,386 (GRCm39) S555R possibly damaging Het
Hmgcs1 G T 13: 120,162,620 (GRCm39) G195W probably damaging Het
Hrc A T 7: 44,985,989 (GRCm39) Y380F possibly damaging Het
Kcnu1 C T 8: 26,409,665 (GRCm39) Q863* probably null Het
Lemd2 G A 17: 27,415,165 (GRCm39) P300L probably damaging Het
Lnpep A T 17: 17,773,172 (GRCm39) Y665* probably null Het
Lrfn1 A G 7: 28,166,564 (GRCm39) T653A probably benign Het
Ly6g6c A G 17: 35,286,387 (GRCm39) T8A unknown Het
Mcm5 T C 8: 75,848,344 (GRCm39) probably null Het
Med28 A T 5: 45,680,794 (GRCm39) D86V probably damaging Het
Mup11 A G 4: 60,615,725 (GRCm39) S171P possibly damaging Het
Nckap1 A G 2: 80,370,542 (GRCm39) F383L probably benign Het
Nid1 G C 13: 13,642,970 (GRCm39) G303R probably benign Het
Nkain3 A G 4: 20,282,892 (GRCm39) V147A probably benign Het
Or12k8 A G 2: 36,975,670 (GRCm39) V30A probably benign Het
Pde9a G A 17: 31,639,258 (GRCm39) V63I possibly damaging Het
Pdlim2 T A 14: 70,411,826 (GRCm39) I69F probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Phf20l1 T C 15: 66,476,638 (GRCm39) I245T probably benign Het
Prmt8 C T 6: 127,666,792 (GRCm39) R394H possibly damaging Het
Prorp A G 12: 55,355,430 (GRCm39) probably null Het
Prpf4b T A 13: 35,067,994 (GRCm39) D274E unknown Het
Psmd6 A T 14: 14,112,225 (GRCm38) probably null Het
Rgs16 T C 1: 153,617,416 (GRCm39) L69P probably damaging Het
Robo3 A T 9: 37,336,020 (GRCm39) I482N probably damaging Het
Scara3 C T 14: 66,168,715 (GRCm39) V301I possibly damaging Het
Serpina1b T A 12: 103,694,553 (GRCm39) H397L probably benign Het
Skint11 T A 4: 114,088,944 (GRCm39) L246Q probably damaging Het
Skint5 T A 4: 113,396,536 (GRCm39) R1212S unknown Het
Slc11a2 T C 15: 100,300,213 (GRCm39) D348G probably benign Het
Slc15a2 T C 16: 36,576,643 (GRCm39) K495E probably benign Het
Son T G 16: 91,458,990 (GRCm39) D2072E unknown Het
Stau1 A G 2: 166,805,494 (GRCm39) V34A probably damaging Het
Stk3 G T 15: 35,073,262 (GRCm39) L153I possibly damaging Het
Swi5 A T 2: 32,177,922 (GRCm39) V13E probably benign Het
Syne2 A T 12: 76,078,172 (GRCm39) probably null Het
Synm T C 7: 67,384,663 (GRCm39) M558V probably benign Het
Tep1 T A 14: 51,062,013 (GRCm39) probably null Het
Tmc6 A G 11: 117,667,151 (GRCm39) V149A probably benign Het
Tmem214 T A 5: 31,028,065 (GRCm39) V95E possibly damaging Het
Tnnt2 T A 1: 135,778,114 (GRCm39) probably null Het
Txlna A G 4: 129,525,071 (GRCm39) probably null Het
Wasf2 G A 4: 132,923,045 (GRCm39) V452I probably damaging Het
Wdr62 C T 7: 29,951,761 (GRCm39) D673N probably damaging Het
Wdr95 C T 5: 149,518,836 (GRCm39) T559I probably benign Het
Zbtb40 A T 4: 136,726,937 (GRCm39) probably null Het
Zfat T C 15: 68,051,856 (GRCm39) E646G probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCCAGTCTCAGCTTGCTTATTG -3'
(R):5'- AGGTGATTAAGTTGCAGATGCC -3'

Sequencing Primer
(F):5'- GCTACCTGACAGCTTCAATGAGG -3'
(R):5'- AAGTTGCAGATGCCATTGTTTG -3'
Posted On 2019-06-26