Incidental Mutation 'R7208:Fcgbp'
ID 560866
Institutional Source Beutler Lab
Gene Symbol Fcgbp
Ensembl Gene ENSMUSG00000047730
Gene Name Fc fragment of IgG binding protein
Synonyms A430096B05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7208 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 28071236-28120862 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28104021 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1683 (H1683Q)
Ref Sequence ENSEMBL: ENSMUSP00000075945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076648] [ENSMUST00000138392]
AlphaFold E9Q0B5
Predicted Effect probably benign
Transcript: ENSMUST00000076648
AA Change: H1683Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075945
Gene: ENSMUSG00000047730
AA Change: H1683Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 1.2e-12 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 6.85e-35 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 4.7e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.7e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 5e-12 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138392
AA Change: H1683Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000114271
Gene: ENSMUSG00000047730
AA Change: H1683Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 8.4e-13 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 7.99e-36 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 3.3e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.9e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 1e-11 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,308,645 probably null Het
Aass T C 6: 23,074,630 K854E probably damaging Het
Abcd2 G T 15: 91,190,682 Y309* probably null Het
Ache G A 5: 137,291,489 G360D probably damaging Het
Acot12 T C 13: 91,781,242 L396P probably benign Het
Acox2 T G 14: 8,241,303 D603A probably benign Het
Adam3 C A 8: 24,711,401 K245N probably damaging Het
Ankhd1 T C 18: 36,625,028 I925T probably benign Het
Arhgap27 C T 11: 103,360,759 V48M probably damaging Het
Atm A T 9: 53,512,008 probably null Het
B4galt4 T A 16: 38,753,940 F92Y probably damaging Het
Brwd1 C T 16: 96,035,959 R891Q probably damaging Het
Calcr T C 6: 3,687,612 Q462R probably benign Het
Ccdc112 T C 18: 46,287,631 R351G probably damaging Het
Ccdc80 T G 16: 45,096,710 S610A probably benign Het
Cdh20 C A 1: 104,954,071 N420K possibly damaging Het
Cntn3 G A 6: 102,278,422 R172* probably null Het
Ctnnd1 G T 2: 84,622,046 Q78K possibly damaging Het
D16Ertd472e A T 16: 78,575,926 L41H probably damaging Het
Dclk2 A T 3: 86,799,602 probably null Het
Dmwd C T 7: 19,080,309 H295Y probably benign Het
Dnaic2 T C 11: 114,757,162 V588A unknown Het
Dtx4 C T 19: 12,482,073 probably null Het
Dync2h1 C A 9: 7,141,059 D1323Y probably damaging Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Gm4070 A C 7: 105,902,179 S555R possibly damaging Het
Gm9195 A G 14: 72,451,752 S1876P possibly damaging Het
Grhl2 A C 15: 37,335,736 K431T probably damaging Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gtf2ird1 T C 5: 134,411,094 N94S probably benign Het
Hmgcs1 G T 13: 119,701,084 G195W probably damaging Het
Hrc A T 7: 45,336,565 Y380F possibly damaging Het
Kcnu1 C T 8: 25,919,637 Q863* probably null Het
Lemd2 G A 17: 27,196,191 P300L probably damaging Het
Lnpep A T 17: 17,552,910 Y665* probably null Het
Lrfn1 A G 7: 28,467,139 T653A probably benign Het
Ly6g6c A G 17: 35,067,411 T8A unknown Het
Mcm5 T C 8: 75,121,716 probably null Het
Med28 A T 5: 45,523,452 D86V probably damaging Het
Mup11 A G 4: 60,659,726 S171P possibly damaging Het
Nckap1 A G 2: 80,540,198 F383L probably benign Het
Nid1 G C 13: 13,468,385 G303R probably benign Het
Nkain3 A G 4: 20,282,892 V147A probably benign Het
Olfr361 A G 2: 37,085,658 V30A probably benign Het
Pde9a G A 17: 31,420,284 V63I possibly damaging Het
Pdlim2 T A 14: 70,174,377 I69F probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phf20l1 T C 15: 66,604,789 I245T probably benign Het
Prmt8 C T 6: 127,689,829 R394H possibly damaging Het
Prpf4b T A 13: 34,884,011 D274E unknown Het
Psmd6 A T 14: 14,112,225 probably null Het
Rgs16 T C 1: 153,741,670 L69P probably damaging Het
Robo3 A T 9: 37,424,724 I482N probably damaging Het
Scara3 C T 14: 65,931,266 V301I possibly damaging Het
Serpina1b T A 12: 103,728,294 H397L probably benign Het
Skint11 T A 4: 114,231,747 L246Q probably damaging Het
Skint5 T A 4: 113,539,339 R1212S unknown Het
Slc11a2 T C 15: 100,402,332 D348G probably benign Het
Slc15a2 T C 16: 36,756,281 K495E probably benign Het
Son T G 16: 91,662,102 D2072E unknown Het
Stau1 A G 2: 166,963,574 V34A probably damaging Het
Stk3 G T 15: 35,073,116 L153I possibly damaging Het
Swi5 A T 2: 32,287,910 V13E probably benign Het
Syne2 A T 12: 76,031,398 probably null Het
Synm T C 7: 67,734,915 M558V probably benign Het
Tep1 T A 14: 50,824,556 probably null Het
Tmc6 A G 11: 117,776,325 V149A probably benign Het
Tmem214 T A 5: 30,870,721 V95E possibly damaging Het
Tnnt2 T A 1: 135,850,376 probably null Het
Txlna A G 4: 129,631,278 probably null Het
Vmn2r26 T C 6: 124,061,989 I841T probably damaging Het
Wasf2 G A 4: 133,195,734 V452I probably damaging Het
Wdr62 C T 7: 30,252,336 D673N probably damaging Het
Wdr78 T G 4: 103,066,352 I427L probably benign Het
Wdr95 C T 5: 149,595,371 T559I probably benign Het
Zbtb40 A T 4: 136,999,626 probably null Het
Zfat T C 15: 68,180,007 E646G probably benign Het
Other mutations in Fcgbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Fcgbp APN 7 28085130 missense probably damaging 1.00
IGL00331:Fcgbp APN 7 28101541 splice site probably benign
IGL00335:Fcgbp APN 7 28086135 missense possibly damaging 0.90
IGL00470:Fcgbp APN 7 28075086 nonsense probably null
IGL00491:Fcgbp APN 7 28093402 missense probably damaging 1.00
IGL00498:Fcgbp APN 7 28091797 missense probably damaging 1.00
IGL01296:Fcgbp APN 7 28089647 missense probably benign 0.15
IGL01582:Fcgbp APN 7 28093642 missense probably benign 0.19
IGL01929:Fcgbp APN 7 28103963 missense probably damaging 1.00
IGL02024:Fcgbp APN 7 28106374 missense probably damaging 1.00
IGL02027:Fcgbp APN 7 28075204 missense probably damaging 1.00
IGL02140:Fcgbp APN 7 28091954 missense probably damaging 1.00
IGL02162:Fcgbp APN 7 28075235 missense probably damaging 1.00
IGL02345:Fcgbp APN 7 28071643 splice site probably benign
IGL02377:Fcgbp APN 7 28106970 missense possibly damaging 0.67
IGL02389:Fcgbp APN 7 28075171 missense probably damaging 1.00
IGL02423:Fcgbp APN 7 28089953 missense probably benign 0.02
IGL02523:Fcgbp APN 7 28104732 missense possibly damaging 0.89
IGL02561:Fcgbp APN 7 28101174 intron probably benign
IGL02631:Fcgbp APN 7 28085298 missense probably damaging 1.00
IGL02716:Fcgbp APN 7 28101434 missense probably damaging 0.98
IGL02836:Fcgbp APN 7 28117358 missense possibly damaging 0.91
IGL02957:Fcgbp APN 7 28091847 nonsense probably null
IGL02971:Fcgbp APN 7 28101473 missense probably damaging 1.00
IGL03284:Fcgbp APN 7 28085432 missense possibly damaging 0.93
IGL03379:Fcgbp APN 7 28089917 missense possibly damaging 0.76
bilge UTSW 7 28117337 missense probably benign 0.00
R6548_fcgbp_365 UTSW 7 28091918 missense probably benign 0.00
swill UTSW 7 28089734 missense probably damaging 1.00
G1citation:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
IGL02796:Fcgbp UTSW 7 28101151 intron probably benign
PIT4486001:Fcgbp UTSW 7 28075273 missense possibly damaging 0.52
R0277:Fcgbp UTSW 7 28085493 critical splice donor site probably null
R0387:Fcgbp UTSW 7 28091454 splice site probably benign
R0586:Fcgbp UTSW 7 28089713 missense probably damaging 1.00
R0981:Fcgbp UTSW 7 28085110 nonsense probably null
R0987:Fcgbp UTSW 7 28094174 missense probably damaging 1.00
R1240:Fcgbp UTSW 7 28120525 missense probably damaging 1.00
R1394:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1395:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1438:Fcgbp UTSW 7 28103733 nonsense probably null
R1474:Fcgbp UTSW 7 28091848 missense probably benign 0.00
R1521:Fcgbp UTSW 7 28075160 missense probably benign 0.00
R1740:Fcgbp UTSW 7 28101249 missense possibly damaging 0.87
R1750:Fcgbp UTSW 7 28093443 nonsense probably null
R1772:Fcgbp UTSW 7 28105175 missense possibly damaging 0.90
R1804:Fcgbp UTSW 7 28086139 missense probably benign
R1808:Fcgbp UTSW 7 28085090 missense probably benign 0.04
R1819:Fcgbp UTSW 7 28085283 missense probably benign 0.00
R1934:Fcgbp UTSW 7 28107093 missense probably damaging 1.00
R1972:Fcgbp UTSW 7 28094192 missense probably benign 0.11
R2051:Fcgbp UTSW 7 28120360 missense probably damaging 0.97
R2072:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2074:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2124:Fcgbp UTSW 7 28092019 missense probably benign 0.03
R2155:Fcgbp UTSW 7 28107203 missense probably benign 0.00
R3015:Fcgbp UTSW 7 28075413 splice site probably benign
R3037:Fcgbp UTSW 7 28102702 missense possibly damaging 0.62
R3151:Fcgbp UTSW 7 28117240 missense probably damaging 1.00
R3176:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3177:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3276:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3277:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3623:Fcgbp UTSW 7 28101276 missense probably damaging 1.00
R3730:Fcgbp UTSW 7 28085457 missense possibly damaging 0.82
R3935:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R3936:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R4041:Fcgbp UTSW 7 28113979 missense probably benign 0.01
R4056:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4057:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4705:Fcgbp UTSW 7 28107296 missense probably benign 0.44
R4708:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4710:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4779:Fcgbp UTSW 7 28094937 missense probably damaging 1.00
R4820:Fcgbp UTSW 7 28113958 missense probably damaging 1.00
R4863:Fcgbp UTSW 7 28086344 missense probably benign 0.33
R4926:Fcgbp UTSW 7 28086235 missense probably damaging 0.99
R4947:Fcgbp UTSW 7 28089812 missense probably benign 0.00
R4979:Fcgbp UTSW 7 28117570 missense probably benign 0.06
R5002:Fcgbp UTSW 7 28086103 splice site probably null
R5219:Fcgbp UTSW 7 28104085 missense probably damaging 1.00
R5241:Fcgbp UTSW 7 28085199 missense probably damaging 1.00
R5301:Fcgbp UTSW 7 28093674 missense possibly damaging 0.93
R5306:Fcgbp UTSW 7 28091818 missense probably damaging 1.00
R5335:Fcgbp UTSW 7 28089734 missense probably damaging 1.00
R5399:Fcgbp UTSW 7 28105055 missense probably benign 0.05
R5418:Fcgbp UTSW 7 28085313 missense probably damaging 1.00
R5527:Fcgbp UTSW 7 28093635 missense probably benign
R5583:Fcgbp UTSW 7 28091579 missense probably damaging 1.00
R5698:Fcgbp UTSW 7 28092022 missense possibly damaging 0.95
R5780:Fcgbp UTSW 7 28085218 missense probably benign 0.02
R5813:Fcgbp UTSW 7 28101494 missense possibly damaging 0.64
R5910:Fcgbp UTSW 7 28085503 splice site probably benign
R5936:Fcgbp UTSW 7 28086692 missense probably damaging 0.98
R5992:Fcgbp UTSW 7 28120534 missense probably benign 0.05
R6091:Fcgbp UTSW 7 28104965 missense possibly damaging 0.90
R6372:Fcgbp UTSW 7 28107008 missense probably damaging 1.00
R6488:Fcgbp UTSW 7 28093538 missense probably damaging 0.96
R6548:Fcgbp UTSW 7 28091918 missense probably benign 0.00
R6553:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6585:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6695:Fcgbp UTSW 7 28086270 nonsense probably null
R6711:Fcgbp UTSW 7 28089673 missense probably damaging 0.99
R6803:Fcgbp UTSW 7 28103212 missense probably benign 0.00
R6822:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
R6907:Fcgbp UTSW 7 28085018 missense probably damaging 1.00
R6912:Fcgbp UTSW 7 28089704 missense probably benign 0.15
R6924:Fcgbp UTSW 7 28093823 missense probably benign
R6943:Fcgbp UTSW 7 28092052 missense probably benign 0.22
R7060:Fcgbp UTSW 7 28091933 missense probably benign 0.20
R7103:Fcgbp UTSW 7 28084962 missense probably benign 0.00
R7291:Fcgbp UTSW 7 28101392 missense probably benign 0.00
R7301:Fcgbp UTSW 7 28093436 missense possibly damaging 0.65
R7404:Fcgbp UTSW 7 28101507 missense probably damaging 1.00
R7426:Fcgbp UTSW 7 28086524 missense probably benign 0.00
R7459:Fcgbp UTSW 7 28107285 missense possibly damaging 0.65
R7475:Fcgbp UTSW 7 28102976 missense probably damaging 0.99
R7505:Fcgbp UTSW 7 28089674 missense probably damaging 0.97
R7517:Fcgbp UTSW 7 28085369 missense probably damaging 1.00
R7519:Fcgbp UTSW 7 28086299 missense probably damaging 1.00
R7524:Fcgbp UTSW 7 28102966 missense probably damaging 1.00
R7649:Fcgbp UTSW 7 28091503 missense possibly damaging 0.88
R7782:Fcgbp UTSW 7 28085035 nonsense probably null
R7820:Fcgbp UTSW 7 28120359 missense probably benign 0.01
R7831:Fcgbp UTSW 7 28106979 missense probably damaging 0.98
R7835:Fcgbp UTSW 7 28117207 missense possibly damaging 0.64
R7947:Fcgbp UTSW 7 28104170 critical splice donor site probably null
R8086:Fcgbp UTSW 7 28113964 missense probably damaging 1.00
R8137:Fcgbp UTSW 7 28105071 missense probably damaging 1.00
R8154:Fcgbp UTSW 7 28085082 missense probably benign 0.00
R8169:Fcgbp UTSW 7 28085494 critical splice donor site probably null
R8176:Fcgbp UTSW 7 28091749 missense possibly damaging 0.88
R8193:Fcgbp UTSW 7 28104851 missense probably damaging 1.00
R8313:Fcgbp UTSW 7 28086344 missense probably benign 0.00
R8350:Fcgbp UTSW 7 28094189 missense probably benign 0.02
R8382:Fcgbp UTSW 7 28117337 missense probably benign 0.00
R8393:Fcgbp UTSW 7 28107390 missense probably benign 0.18
R8438:Fcgbp UTSW 7 28089806 missense probably benign 0.25
R8489:Fcgbp UTSW 7 28105010 missense possibly damaging 0.94
R8495:Fcgbp UTSW 7 28086553 missense probably damaging 1.00
R8707:Fcgbp UTSW 7 28120495 missense probably benign 0.01
R8736:Fcgbp UTSW 7 28106196 missense probably benign 0.05
R8816:Fcgbp UTSW 7 28084987 missense probably benign 0.09
R8905:Fcgbp UTSW 7 28086509 missense probably damaging 1.00
R9031:Fcgbp UTSW 7 28091483 missense possibly damaging 0.89
R9063:Fcgbp UTSW 7 28091852 missense probably damaging 1.00
R9180:Fcgbp UTSW 7 28103773 nonsense probably null
R9262:Fcgbp UTSW 7 28120527 missense probably damaging 1.00
R9439:Fcgbp UTSW 7 28104011 missense not run
RF002:Fcgbp UTSW 7 28089755 missense probably benign
X0028:Fcgbp UTSW 7 28104020 missense possibly damaging 0.48
Z1186:Fcgbp UTSW 7 28086191 missense probably benign
Z1186:Fcgbp UTSW 7 28089755 missense probably benign
Z1186:Fcgbp UTSW 7 28091647 missense probably benign
Z1186:Fcgbp UTSW 7 28093345 missense probably benign
Z1186:Fcgbp UTSW 7 28103884 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGACTCCTTGGTCTGCAAGC -3'
(R):5'- GCTGGGAAAGATGCTCTGTAC -3'

Sequencing Primer
(F):5'- AAGCCTGCCAGCTGTGG -3'
(R):5'- TGGGAAAGATGCTCTGTACACCAG -3'
Posted On 2019-06-26