Incidental Mutation 'R7208:Hrc'
ID560869
Institutional Source Beutler Lab
Gene Symbol Hrc
Ensembl Gene ENSMUSG00000038239
Gene Namehistidine rich calcium binding protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7208 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45335290-45338974 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45336565 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 380 (Y380F)
Ref Sequence ENSEMBL: ENSMUSP00000082459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003961] [ENSMUST00000042194] [ENSMUST00000085351] [ENSMUST00000210248] [ENSMUST00000210541] [ENSMUST00000211067] [ENSMUST00000211327] [ENSMUST00000211431] [ENSMUST00000211743]
Predicted Effect probably benign
Transcript: ENSMUST00000003961
SMART Domains Protein: ENSMUSP00000003961
Gene: ENSMUSG00000003863

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042194
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085351
AA Change: Y380F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082459
Gene: ENSMUSG00000038239
AA Change: Y380F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 32 45 N/A INTRINSIC
internal_repeat_1 51 146 8.76e-11 PROSPERO
low complexity region 154 189 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 213 225 1e-4 PFAM
low complexity region 240 254 N/A INTRINSIC
low complexity region 260 274 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 308 324 2.2e-8 PFAM
low complexity region 340 353 N/A INTRINSIC
low complexity region 362 382 N/A INTRINSIC
internal_repeat_1 399 490 8.76e-11 PROSPERO
coiled coil region 536 565 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
coiled coil region 594 621 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210248
Predicted Effect probably benign
Transcript: ENSMUST00000210541
Predicted Effect probably benign
Transcript: ENSMUST00000211067
Predicted Effect probably benign
Transcript: ENSMUST00000211327
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect probably benign
Transcript: ENSMUST00000211743
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in impaired weight gain and weight loss around 1 year of age and increased susceptibility to induced cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,308,645 probably null Het
Aass T C 6: 23,074,630 K854E probably damaging Het
Abcd2 G T 15: 91,190,682 Y309* probably null Het
Ache G A 5: 137,291,489 G360D probably damaging Het
Acot12 T C 13: 91,781,242 L396P probably benign Het
Acox2 T G 14: 8,241,303 D603A probably benign Het
Adam3 C A 8: 24,711,401 K245N probably damaging Het
Ankhd1 T C 18: 36,625,028 I925T probably benign Het
Arhgap27 C T 11: 103,360,759 V48M probably damaging Het
Atm A T 9: 53,512,008 probably null Het
B4galt4 T A 16: 38,753,940 F92Y probably damaging Het
Brwd1 C T 16: 96,035,959 R891Q probably damaging Het
Calcr T C 6: 3,687,612 Q462R probably benign Het
Ccdc112 T C 18: 46,287,631 R351G probably damaging Het
Ccdc80 T G 16: 45,096,710 S610A probably benign Het
Cdh20 C A 1: 104,954,071 N420K possibly damaging Het
Cntn3 G A 6: 102,278,422 R172* probably null Het
Ctnnd1 G T 2: 84,622,046 Q78K possibly damaging Het
D16Ertd472e A T 16: 78,575,926 L41H probably damaging Het
Dclk2 A T 3: 86,799,602 probably null Het
Dmwd C T 7: 19,080,309 H295Y probably benign Het
Dnaic2 T C 11: 114,757,162 V588A unknown Het
Dtx4 C T 19: 12,482,073 probably null Het
Dync2h1 C A 9: 7,141,059 D1323Y probably damaging Het
Fcgbp T A 7: 28,104,021 H1683Q probably benign Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Gm4070 A C 7: 105,902,179 S555R possibly damaging Het
Gm9195 A G 14: 72,451,752 S1876P possibly damaging Het
Grhl2 A C 15: 37,335,736 K431T probably damaging Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gtf2ird1 T C 5: 134,411,094 N94S probably benign Het
Hmgcs1 G T 13: 119,701,084 G195W probably damaging Het
Kcnu1 C T 8: 25,919,637 Q863* probably null Het
Lemd2 G A 17: 27,196,191 P300L probably damaging Het
Lnpep A T 17: 17,552,910 Y665* probably null Het
Lrfn1 A G 7: 28,467,139 T653A probably benign Het
Ly6g6c A G 17: 35,067,411 T8A unknown Het
Mcm5 T C 8: 75,121,716 probably null Het
Med28 A T 5: 45,523,452 D86V probably damaging Het
Mup11 A G 4: 60,659,726 S171P possibly damaging Het
Nckap1 A G 2: 80,540,198 F383L probably benign Het
Nid1 G C 13: 13,468,385 G303R probably benign Het
Nkain3 A G 4: 20,282,892 V147A probably benign Het
Olfr361 A G 2: 37,085,658 V30A probably benign Het
Pde9a G A 17: 31,420,284 V63I possibly damaging Het
Pdlim2 T A 14: 70,174,377 I69F probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phf20l1 T C 15: 66,604,789 I245T probably benign Het
Prmt8 C T 6: 127,689,829 R394H possibly damaging Het
Prpf4b T A 13: 34,884,011 D274E unknown Het
Psmd6 A T 14: 14,112,225 probably null Het
Rgs16 T C 1: 153,741,670 L69P probably damaging Het
Robo3 A T 9: 37,424,724 I482N probably damaging Het
Scara3 C T 14: 65,931,266 V301I possibly damaging Het
Serpina1b T A 12: 103,728,294 H397L probably benign Het
Skint11 T A 4: 114,231,747 L246Q probably damaging Het
Skint5 T A 4: 113,539,339 R1212S unknown Het
Slc11a2 T C 15: 100,402,332 D348G probably benign Het
Slc15a2 T C 16: 36,756,281 K495E probably benign Het
Son T G 16: 91,662,102 D2072E unknown Het
Stau1 A G 2: 166,963,574 V34A probably damaging Het
Stk3 G T 15: 35,073,116 L153I possibly damaging Het
Swi5 A T 2: 32,287,910 V13E probably benign Het
Syne2 A T 12: 76,031,398 probably null Het
Synm T C 7: 67,734,915 M558V probably benign Het
Tep1 T A 14: 50,824,556 probably null Het
Tmc6 A G 11: 117,776,325 V149A probably benign Het
Tmem214 T A 5: 30,870,721 V95E possibly damaging Het
Tnnt2 T A 1: 135,850,376 probably null Het
Txlna A G 4: 129,631,278 probably null Het
Vmn2r26 T C 6: 124,061,989 I841T probably damaging Het
Wasf2 G A 4: 133,195,734 V452I probably damaging Het
Wdr62 C T 7: 30,252,336 D673N probably damaging Het
Wdr78 T G 4: 103,066,352 I427L probably benign Het
Wdr95 C T 5: 149,595,371 T559I probably benign Het
Zbtb40 A T 4: 136,999,626 probably null Het
Zfat T C 15: 68,180,007 E646G probably benign Het
Other mutations in Hrc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03379:Hrc APN 7 45337255 missense probably benign 0.27
BB004:Hrc UTSW 7 45336053 missense possibly damaging 0.53
BB014:Hrc UTSW 7 45336053 missense possibly damaging 0.53
R0017:Hrc UTSW 7 45336370 missense possibly damaging 0.71
R0047:Hrc UTSW 7 45336689 missense probably benign 0.00
R0047:Hrc UTSW 7 45336689 missense probably benign 0.00
R0310:Hrc UTSW 7 45336497 missense probably benign
R0436:Hrc UTSW 7 45336133 missense possibly damaging 0.53
R0534:Hrc UTSW 7 45337235 unclassified probably benign
R1230:Hrc UTSW 7 45336463 missense possibly damaging 0.85
R1808:Hrc UTSW 7 45336778 missense probably damaging 0.99
R1975:Hrc UTSW 7 45336214 missense probably damaging 0.98
R1977:Hrc UTSW 7 45336214 missense probably damaging 0.98
R2258:Hrc UTSW 7 45336681 missense possibly damaging 0.68
R2260:Hrc UTSW 7 45336681 missense possibly damaging 0.68
R3551:Hrc UTSW 7 45336333 missense possibly damaging 0.72
R3552:Hrc UTSW 7 45336333 missense possibly damaging 0.72
R4169:Hrc UTSW 7 45336757 missense probably benign 0.00
R5085:Hrc UTSW 7 45337021 missense probably damaging 0.99
R5204:Hrc UTSW 7 45335704 missense possibly damaging 0.96
R5215:Hrc UTSW 7 45336091 missense probably damaging 0.99
R5245:Hrc UTSW 7 45335431 missense probably damaging 1.00
R5390:Hrc UTSW 7 45335485 missense probably damaging 0.96
R5432:Hrc UTSW 7 45336861 missense possibly damaging 0.72
R5756:Hrc UTSW 7 45336706 missense possibly damaging 0.85
R5761:Hrc UTSW 7 45336601 unclassified probably null
R5905:Hrc UTSW 7 45336234 missense probably damaging 0.99
R6144:Hrc UTSW 7 45336733 missense possibly damaging 0.86
R6684:Hrc UTSW 7 45336532 missense possibly damaging 0.53
R6699:Hrc UTSW 7 45335695 missense possibly damaging 0.85
R6809:Hrc UTSW 7 45336379 missense probably benign
R6887:Hrc UTSW 7 45335664 missense probably benign 0.18
R7178:Hrc UTSW 7 45336261 missense possibly damaging 0.53
R7258:Hrc UTSW 7 45336296 missense possibly damaging 0.70
R7310:Hrc UTSW 7 45335803 nonsense probably null
R7456:Hrc UTSW 7 45336896 missense possibly damaging 0.83
R7525:Hrc UTSW 7 45336379 missense probably benign
R7673:Hrc UTSW 7 45337234 missense probably benign 0.00
R7734:Hrc UTSW 7 45336676 missense probably benign 0.06
R7927:Hrc UTSW 7 45336053 missense possibly damaging 0.53
R8080:Hrc UTSW 7 45336838 missense probably damaging 0.96
Z1177:Hrc UTSW 7 45336970 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGAAGACGGTGACTCTGGTG -3'
(R):5'- CTGTCAGCATTGTGGCCTTG -3'

Sequencing Primer
(F):5'- TGACTCTGGTGAATACAGACAC -3'
(R):5'- CATTGTGGCCTTGGGGAC -3'
Posted On2019-06-26