Mutagenetix > Incidental Mutation

Incidental Mutation 'R7209:Cr2'

560915

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

045338-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R7209 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 195168724 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 145 (C145R)

Ref Sequence

ENSEMBL: ENSMUSP00000147804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043104] [ENSMUST00000082321] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000043104
AA Change: C125R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616
AA Change: C125R

Domain	Start	End	E-Value	Type
CCP	2	58	5.04e-7	SMART
CCP	63	120	3.58e-12	SMART
CCP	125	191	1.2e-13	SMART
CCP	197	252	2.73e-17	SMART
CCP	256	311	1.01e-15	SMART
Blast:CCP	316	347	2e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000082321

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000195120

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000210219
AA Change: C145R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	A	1: 105,750,357	P1136T	probably damaging	Het
Adam7	A	G	14: 68,529,819	Y61H	probably damaging	Het
Adgrb1	T	G	15: 74,569,948	V966G	possibly damaging	Het
Adh5	G	A	3: 138,443,148		probably benign	Het
Akr1b8	T	C	6: 34,356,272	V28A	probably damaging	Het
Apbb1	T	A	7: 105,566,085	I450F	probably damaging	Het
Arhgap23	G	C	11: 97,492,447		probably null	Het
Arhgap23	C	T	11: 97,476,085	T1064I	probably damaging	Het
Atg4b	A	G	1: 93,775,233	I128M	probably damaging	Het
B230118H07Rik	T	C	2: 101,566,382	*217W	probably null	Het
Baat	A	T	4: 49,503,065	I19N	probably damaging	Het
Bspry	T	G	4: 62,486,615	I216S	possibly damaging	Het
Commd9	T	A	2: 101,895,138	S19T	possibly damaging	Het
Cyp2c68	A	G	19: 39,689,205	L447P	probably damaging	Het
Depdc1b	T	C	13: 108,382,855	M333T	possibly damaging	Het
Dhx9	T	C	1: 153,464,623	T710A	possibly damaging	Het
Dnah5	T	C	15: 28,459,225	V4530A	possibly damaging	Het
Dohh	T	A	10: 81,386,040	H89Q	probably damaging	Het
Dopey2	T	A	16: 93,769,845	N1171K	probably benign	Het
Dscam	T	C	16: 96,650,344		probably null	Het
Entpd5	T	A	12: 84,396,928	S14C	probably benign	Het
Eqtn	G	A	4: 94,925,569	S125F	probably damaging	Het
Erp44	A	T	4: 48,211,704	D197E	probably benign	Het
Fgf18	A	T	11: 33,134,315	D46E	probably benign	Het
Foxa1	T	A	12: 57,543,291	M48L	probably benign	Het
Gabrg1	C	A	5: 70,754,170	C417F	probably damaging	Het
Glrp1	T	A	1: 88,503,282	Q122L	unknown	Het
Gm5286	A	T	3: 94,198,705	Q110L	probably benign	Het
Gm5622	A	G	14: 51,655,906	I97V	possibly damaging	Het
Gusb	A	G	5: 129,998,546	V306A	probably benign	Het
Hars	A	G	18: 36,773,540	S126P	probably benign	Het
Herc1	A	G	9: 66,385,032	S356G	possibly damaging	Het
Hydin	C	A	8: 110,489,792	Y1336*	probably null	Het
Kin	T	C	2: 10,091,753	Y138H	possibly damaging	Het
Lypd2	C	T	15: 74,732,417	V101M	probably benign	Het
Madcam1	A	T	10: 79,665,058	T70S	possibly damaging	Het
Man1a2	A	G	3: 100,647,079	C112R	unknown	Het
Mia2	T	A	12: 59,154,390	V198E	possibly damaging	Het
Mpdz	C	T	4: 81,306,877	V1438M	possibly damaging	Het
Mtif2	G	A	11: 29,529,996	V21M	probably benign	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nln	G	A	13: 104,072,898	Q56*	probably null	Het
Nlrp4b	T	C	7: 10,710,370	V82A	probably benign	Het
Obscn	C	A	11: 59,085,107	E2065*	probably null	Het
Olfr1510	A	G	14: 52,410,093	C260R	possibly damaging	Het
Pilrb2	C	T	5: 137,870,864		probably null	Het
Plekhh1	C	A	12: 79,050,376	D99E	probably benign	Het
Polr2b	T	A	5: 77,343,179	F956I	probably damaging	Het
Ppp3cc	A	G	14: 70,267,498	F20L	probably benign	Het
Prmt9	T	C	8: 77,564,998	V333A	probably benign	Het
Psd4	T	C	2: 24,397,345	S430P	probably damaging	Het
Rrp12	A	C	19: 41,872,949	V973G	possibly damaging	Het
Rxfp2	A	G	5: 150,053,098		probably null	Het
S100a6	G	A	3: 90,613,788	A8T	possibly damaging	Het
Sgsm2	C	A	11: 74,854,325	G717V	probably damaging	Het
Sipa1	A	G	19: 5,654,975	Y531H	probably damaging	Het
Slc45a1	A	C	4: 150,635,212		probably null	Het
Srbd1	C	A	17: 86,001,520	L743F	probably damaging	Het
Taar2	A	T	10: 23,940,699	I46F	possibly damaging	Het
Tcrg-C3	A	G	13: 19,261,164	N94S	probably benign	Het
Tmem241	A	T	18: 12,104,172	V69D	probably damaging	Het
Tns1	T	C	1: 73,953,915	S535G	possibly damaging	Het
Ttc34	C	A	4: 154,839,128	P98Q	probably damaging	Het
Ubr1	C	A	2: 120,862,765	R1720L	probably benign	Het
Ubr3	T	A	2: 70,016,134	D1597E	probably benign	Het
Unc79	T	C	12: 103,125,624	M1930T	probably benign	Het
Vmn2r100	A	T	17: 19,531,314	I603F	not run	Het
Vps26b	A	T	9: 27,009,992	S304T	probably benign	Het
Zfp952	A	T	17: 33,003,470	T308S	possibly damaging	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- CACTGAGGAGGTGGACTATTCC -3'
(R):5'- TGACTTTTCAATCAGCTGGTTC -3'

Sequencing Primer
(F):5'- GGACTATTCCAGATGCCAACTTG -3'
(R):5'- AATCAGCTGGTTCCATTTATTTTCC -3'

Posted On

2019-06-26