Incidental Mutation 'R7209:Cr2'
ID 560915
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-1, Cr1, CD35, Cr-2
MMRRC Submission 045338-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R7209 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 195136811-195176716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 195168724 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 145 (C145R)
Ref Sequence ENSEMBL: ENSMUSP00000147804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043104] [ENSMUST00000082321] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043104
AA Change: C125R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616
AA Change: C125R

DomainStartEndE-ValueType
CCP 2 58 5.04e-7 SMART
CCP 63 120 3.58e-12 SMART
CCP 125 191 1.2e-13 SMART
CCP 197 252 2.73e-17 SMART
CCP 256 311 1.01e-15 SMART
Blast:CCP 316 347 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000082321
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195120
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210219
AA Change: C145R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,750,357 P1136T probably damaging Het
Adam7 A G 14: 68,529,819 Y61H probably damaging Het
Adgrb1 T G 15: 74,569,948 V966G possibly damaging Het
Adh5 G A 3: 138,443,148 probably benign Het
Akr1b8 T C 6: 34,356,272 V28A probably damaging Het
Apbb1 T A 7: 105,566,085 I450F probably damaging Het
Arhgap23 G C 11: 97,492,447 probably null Het
Arhgap23 C T 11: 97,476,085 T1064I probably damaging Het
Atg4b A G 1: 93,775,233 I128M probably damaging Het
B230118H07Rik T C 2: 101,566,382 *217W probably null Het
Baat A T 4: 49,503,065 I19N probably damaging Het
Bspry T G 4: 62,486,615 I216S possibly damaging Het
Commd9 T A 2: 101,895,138 S19T possibly damaging Het
Cyp2c68 A G 19: 39,689,205 L447P probably damaging Het
Depdc1b T C 13: 108,382,855 M333T possibly damaging Het
Dhx9 T C 1: 153,464,623 T710A possibly damaging Het
Dnah5 T C 15: 28,459,225 V4530A possibly damaging Het
Dohh T A 10: 81,386,040 H89Q probably damaging Het
Dopey2 T A 16: 93,769,845 N1171K probably benign Het
Dscam T C 16: 96,650,344 probably null Het
Entpd5 T A 12: 84,396,928 S14C probably benign Het
Eqtn G A 4: 94,925,569 S125F probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fgf18 A T 11: 33,134,315 D46E probably benign Het
Foxa1 T A 12: 57,543,291 M48L probably benign Het
Gabrg1 C A 5: 70,754,170 C417F probably damaging Het
Glrp1 T A 1: 88,503,282 Q122L unknown Het
Gm5286 A T 3: 94,198,705 Q110L probably benign Het
Gm5622 A G 14: 51,655,906 I97V possibly damaging Het
Gusb A G 5: 129,998,546 V306A probably benign Het
Hars A G 18: 36,773,540 S126P probably benign Het
Herc1 A G 9: 66,385,032 S356G possibly damaging Het
Hydin C A 8: 110,489,792 Y1336* probably null Het
Kin T C 2: 10,091,753 Y138H possibly damaging Het
Lypd2 C T 15: 74,732,417 V101M probably benign Het
Madcam1 A T 10: 79,665,058 T70S possibly damaging Het
Man1a2 A G 3: 100,647,079 C112R unknown Het
Mia2 T A 12: 59,154,390 V198E possibly damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Mtif2 G A 11: 29,529,996 V21M probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nln G A 13: 104,072,898 Q56* probably null Het
Nlrp4b T C 7: 10,710,370 V82A probably benign Het
Obscn C A 11: 59,085,107 E2065* probably null Het
Olfr1510 A G 14: 52,410,093 C260R possibly damaging Het
Pilrb2 C T 5: 137,870,864 probably null Het
Plekhh1 C A 12: 79,050,376 D99E probably benign Het
Polr2b T A 5: 77,343,179 F956I probably damaging Het
Ppp3cc A G 14: 70,267,498 F20L probably benign Het
Prmt9 T C 8: 77,564,998 V333A probably benign Het
Psd4 T C 2: 24,397,345 S430P probably damaging Het
Rrp12 A C 19: 41,872,949 V973G possibly damaging Het
Rxfp2 A G 5: 150,053,098 probably null Het
S100a6 G A 3: 90,613,788 A8T possibly damaging Het
Sgsm2 C A 11: 74,854,325 G717V probably damaging Het
Sipa1 A G 19: 5,654,975 Y531H probably damaging Het
Slc45a1 A C 4: 150,635,212 probably null Het
Srbd1 C A 17: 86,001,520 L743F probably damaging Het
Taar2 A T 10: 23,940,699 I46F possibly damaging Het
Tcrg-C3 A G 13: 19,261,164 N94S probably benign Het
Tmem241 A T 18: 12,104,172 V69D probably damaging Het
Tns1 T C 1: 73,953,915 S535G possibly damaging Het
Ttc34 C A 4: 154,839,128 P98Q probably damaging Het
Ubr1 C A 2: 120,862,765 R1720L probably benign Het
Ubr3 T A 2: 70,016,134 D1597E probably benign Het
Unc79 T C 12: 103,125,624 M1930T probably benign Het
Vmn2r100 A T 17: 19,531,314 I603F not run Het
Vps26b A T 9: 27,009,992 S304T probably benign Het
Zfp952 A T 17: 33,003,470 T308S possibly damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
R7414:Cr2 UTSW 1 195150036 missense probably benign
R7453:Cr2 UTSW 1 195165257 splice site probably null
R7479:Cr2 UTSW 1 195158410 critical splice donor site probably null
R7480:Cr2 UTSW 1 195154176 missense probably damaging 1.00
R7570:Cr2 UTSW 1 195169340 nonsense probably null
R7666:Cr2 UTSW 1 195154225 missense probably damaging 1.00
R7921:Cr2 UTSW 1 195151667 missense possibly damaging 0.94
R7923:Cr2 UTSW 1 195168687 missense probably benign 0.03
R8396:Cr2 UTSW 1 195158068 missense probably damaging 1.00
R8503:Cr2 UTSW 1 195163542 missense probably benign
R8517:Cr2 UTSW 1 195155899 missense probably benign 0.03
R8773:Cr2 UTSW 1 195158605 missense probably damaging 1.00
R8849:Cr2 UTSW 1 195157239 missense probably damaging 1.00
R8896:Cr2 UTSW 1 195169273 missense possibly damaging 0.58
R8938:Cr2 UTSW 1 195171116 missense probably damaging 0.99
R9027:Cr2 UTSW 1 195151721 missense probably benign 0.08
R9045:Cr2 UTSW 1 195155372 missense possibly damaging 0.61
R9116:Cr2 UTSW 1 195158669 nonsense probably null
R9137:Cr2 UTSW 1 195168332 critical splice donor site probably null
R9476:Cr2 UTSW 1 195158108 missense probably damaging 0.97
R9497:Cr2 UTSW 1 195168435 missense probably damaging 0.99
R9510:Cr2 UTSW 1 195158108 missense probably damaging 0.97
R9752:Cr2 UTSW 1 195141267 missense probably benign 0.37
R9799:Cr2 UTSW 1 195160680 missense probably benign 0.02
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Z1176:Cr2 UTSW 1 195154153 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CACTGAGGAGGTGGACTATTCC -3'
(R):5'- TGACTTTTCAATCAGCTGGTTC -3'

Sequencing Primer
(F):5'- GGACTATTCCAGATGCCAACTTG -3'
(R):5'- AATCAGCTGGTTCCATTTATTTTCC -3'
Posted On 2019-06-26