Mutagenetix > Incidental Mutations

Incidental Mutation 'R7209:Ubr3'

560918

Institutional Source

Beutler Lab

Gene Symbol

Ubr3

Ensembl Gene

ENSMUSG00000044308

Gene Name

ubiquitin protein ligase E3 component n-recognin 3

Synonyms

Zfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7209 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69897246-70024013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70016134 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1597 (D1597E)

Ref Sequence

ENSEMBL: ENSMUSP00000060159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]

Predicted Effect

probably benign
Transcript: ENSMUST00000055758
AA Change: D1597E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: D1597E

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	118	188	1.6e-19	PFAM
low complexity region	339	354	N/A	INTRINSIC
low complexity region	570	580	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
low complexity region	1082	1101	N/A	INTRINSIC
coiled coil region	1167	1199	N/A	INTRINSIC
Blast:RING	1289	1363	8e-39	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000112251
AA Change: D1600E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: D1600E

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	119	187	1.7e-21	PFAM
low complexity region	338	353	N/A	INTRINSIC
low complexity region	569	579	N/A	INTRINSIC
low complexity region	1015	1026	N/A	INTRINSIC
low complexity region	1081	1100	N/A	INTRINSIC
coiled coil region	1166	1198	N/A	INTRINSIC
Blast:RING	1288	1362	8e-39	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (67/67)

MGI Phenotype

PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	A	1: 105,750,357	P1136T	probably damaging	Het
Adam7	A	G	14: 68,529,819	Y61H	probably damaging	Het
Adgrb1	T	G	15: 74,569,948	V966G	possibly damaging	Het
Adh5	G	A	3: 138,443,148		probably benign	Het
Akr1b8	T	C	6: 34,356,272	V28A	probably damaging	Het
Apbb1	T	A	7: 105,566,085	I450F	probably damaging	Het
Arhgap23	G	C	11: 97,492,447		probably null	Het
Arhgap23	C	T	11: 97,476,085	T1064I	probably damaging	Het
Atg4b	A	G	1: 93,775,233	I128M	probably damaging	Het
B230118H07Rik	T	C	2: 101,566,382	*217W	probably null	Het
Baat	A	T	4: 49,503,065	I19N	probably damaging	Het
Bspry	T	G	4: 62,486,615	I216S	possibly damaging	Het
Commd9	T	A	2: 101,895,138	S19T	possibly damaging	Het
Cr2	A	G	1: 195,168,724	C145R	probably damaging	Het
Cyp2c68	A	G	19: 39,689,205	L447P	probably damaging	Het
Depdc1b	T	C	13: 108,382,855	M333T	possibly damaging	Het
Dhx9	T	C	1: 153,464,623	T710A	possibly damaging	Het
Dnah5	T	C	15: 28,459,225	V4530A	possibly damaging	Het
Dohh	T	A	10: 81,386,040	H89Q	probably damaging	Het
Dopey2	T	A	16: 93,769,845	N1171K	probably benign	Het
Dscam	T	C	16: 96,650,344		probably null	Het
Entpd5	T	A	12: 84,396,928	S14C	probably benign	Het
Eqtn	G	A	4: 94,925,569	S125F	probably damaging	Het
Erp44	A	T	4: 48,211,704	D197E	probably benign	Het
Fgf18	A	T	11: 33,134,315	D46E	probably benign	Het
Foxa1	T	A	12: 57,543,291	M48L	probably benign	Het
Gabrg1	C	A	5: 70,754,170	C417F	probably damaging	Het
Glrp1	T	A	1: 88,503,282	Q122L	unknown	Het
Gm5286	A	T	3: 94,198,705	Q110L	probably benign	Het
Gm5622	A	G	14: 51,655,906	I97V	possibly damaging	Het
Gusb	A	G	5: 129,998,546	V306A	probably benign	Het
Hars	A	G	18: 36,773,540	S126P	probably benign	Het
Herc1	A	G	9: 66,385,032	S356G	possibly damaging	Het
Hydin	C	A	8: 110,489,792	Y1336*	probably null	Het
Kin	T	C	2: 10,091,753	Y138H	possibly damaging	Het
Lypd2	C	T	15: 74,732,417	V101M	probably benign	Het
Madcam1	A	T	10: 79,665,058	T70S	possibly damaging	Het
Man1a2	A	G	3: 100,647,079	C112R	unknown	Het
Mia2	T	A	12: 59,154,390	V198E	possibly damaging	Het
Mpdz	C	T	4: 81,306,877	V1438M	possibly damaging	Het
Mtif2	G	A	11: 29,529,996	V21M	probably benign	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nln	G	A	13: 104,072,898	Q56*	probably null	Het
Nlrp4b	T	C	7: 10,710,370	V82A	probably benign	Het
Obscn	C	A	11: 59,085,107	E2065*	probably null	Het
Olfr1510	A	G	14: 52,410,093	C260R	possibly damaging	Het
Pilrb2	C	T	5: 137,870,864		probably null	Het
Plekhh1	C	A	12: 79,050,376	D99E	probably benign	Het
Polr2b	T	A	5: 77,343,179	F956I	probably damaging	Het
Ppp3cc	A	G	14: 70,267,498	F20L	probably benign	Het
Prmt9	T	C	8: 77,564,998	V333A	probably benign	Het
Psd4	T	C	2: 24,397,345	S430P	probably damaging	Het
Rrp12	A	C	19: 41,872,949	V973G	possibly damaging	Het
Rxfp2	A	G	5: 150,053,098		probably null	Het
S100a6	G	A	3: 90,613,788	A8T	possibly damaging	Het
Sgsm2	C	A	11: 74,854,325	G717V	probably damaging	Het
Sipa1	A	G	19: 5,654,975	Y531H	probably damaging	Het
Slc45a1	A	C	4: 150,635,212		probably null	Het
Srbd1	C	A	17: 86,001,520	L743F	probably damaging	Het
Taar2	A	T	10: 23,940,699	I46F	possibly damaging	Het
Tcrg-C3	A	G	13: 19,261,164	N94S	probably benign	Het
Tmem241	A	T	18: 12,104,172	V69D	probably damaging	Het
Tns1	T	C	1: 73,953,915	S535G	possibly damaging	Het
Ttc34	C	A	4: 154,839,128	P98Q	probably damaging	Het
Ubr1	C	A	2: 120,862,765	R1720L	probably benign	Het
Unc79	T	C	12: 103,125,624	M1930T	probably benign	Het
Vmn2r100	A	T	17: 19,531,314	I603F	not run	Het
Vps26b	A	T	9: 27,009,992	S304T	probably benign	Het
Zfp952	A	T	17: 33,003,470	T308S	possibly damaging	Het

Other mutations in Ubr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ubr3	APN	2	69988810	missense	probably benign	0.40
IGL00985:Ubr3	APN	2	70003431	missense	probably damaging	1.00
IGL01061:Ubr3	APN	2	69983225	missense	probably benign	0.05
IGL01325:Ubr3	APN	2	69917097	missense	possibly damaging	0.71
IGL01398:Ubr3	APN	2	69959653	missense	probably damaging	1.00
IGL01484:Ubr3	APN	2	70021544	nonsense	probably null
IGL01599:Ubr3	APN	2	69938178	missense	probably damaging	1.00
IGL01616:Ubr3	APN	2	70020484	missense	probably benign	0.14
IGL01634:Ubr3	APN	2	69973572	missense	probably benign
IGL01684:Ubr3	APN	2	70016158	nonsense	probably null
IGL01810:Ubr3	APN	2	70003465	splice site	probably null
IGL01813:Ubr3	APN	2	69951570	missense	probably benign	0.34
IGL01994:Ubr3	APN	2	70021176	missense	probably damaging	1.00
IGL02188:Ubr3	APN	2	69959611	nonsense	probably null
IGL02318:Ubr3	APN	2	69979397	missense	probably damaging	1.00
IGL02379:Ubr3	APN	2	69948488	missense	possibly damaging	0.91
IGL02635:Ubr3	APN	2	70020483	missense	probably damaging	0.96
IGL02858:Ubr3	APN	2	69952859	missense	probably damaging	1.00
IGL03140:Ubr3	APN	2	69970189	missense	probably damaging	1.00
IGL03343:Ubr3	APN	2	69973146	splice site	probably benign
Hyrax	UTSW	2	69952868	missense	probably benign	0.32
manatee	UTSW	2	69979386	nonsense	probably null
sea_cow	UTSW	2	69959669	splice site	probably null
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0122:Ubr3	UTSW	2	69979412	missense	probably damaging	1.00
R0243:Ubr3	UTSW	2	69951405	missense	probably damaging	1.00
R0710:Ubr3	UTSW	2	69952837	missense	probably damaging	1.00
R0787:Ubr3	UTSW	2	69951421	splice site	probably benign
R1137:Ubr3	UTSW	2	69938315	splice site	probably benign
R1191:Ubr3	UTSW	2	70021181	nonsense	probably null
R1416:Ubr3	UTSW	2	69945071	missense	probably damaging	1.00
R1623:Ubr3	UTSW	2	69977723	nonsense	probably null
R1735:Ubr3	UTSW	2	70009129	missense	probably damaging	1.00
R1789:Ubr3	UTSW	2	70016367	missense	possibly damaging	0.87
R1793:Ubr3	UTSW	2	70000551	splice site	probably benign
R1932:Ubr3	UTSW	2	69953476	splice site	probably null
R2042:Ubr3	UTSW	2	69977774	nonsense	probably null
R2085:Ubr3	UTSW	2	69953764	missense	probably damaging	1.00
R2090:Ubr3	UTSW	2	69936017	missense	probably damaging	1.00
R2112:Ubr3	UTSW	2	69977792	missense	possibly damaging	0.73
R2173:Ubr3	UTSW	2	69897399	missense	probably benign
R2215:Ubr3	UTSW	2	69979317	critical splice acceptor site	probably null
R2273:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2274:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2275:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2292:Ubr3	UTSW	2	69897260	unclassified	probably benign
R2447:Ubr3	UTSW	2	70003380	missense	probably damaging	1.00
R2504:Ubr3	UTSW	2	69938198	missense	probably damaging	0.99
R2517:Ubr3	UTSW	2	69936018	missense	probably damaging	1.00
R2901:Ubr3	UTSW	2	70016192	missense	possibly damaging	0.89
R3109:Ubr3	UTSW	2	69988840	missense	probably damaging	1.00
R3737:Ubr3	UTSW	2	69971234	critical splice donor site	probably null
R3793:Ubr3	UTSW	2	69917181	missense	possibly damaging	0.95
R3821:Ubr3	UTSW	2	69993813	critical splice donor site	probably null
R3918:Ubr3	UTSW	2	70016130	critical splice acceptor site	probably null
R4157:Ubr3	UTSW	2	69959669	splice site	probably null
R4235:Ubr3	UTSW	2	70016385	nonsense	probably null
R4276:Ubr3	UTSW	2	69938387	nonsense	probably null
R4544:Ubr3	UTSW	2	69956093	missense	probably benign	0.18
R4678:Ubr3	UTSW	2	69935919	missense	probably damaging	1.00
R4707:Ubr3	UTSW	2	69938370	intron	probably benign
R4785:Ubr3	UTSW	2	69959603	missense	probably damaging	1.00
R4872:Ubr3	UTSW	2	69970183	missense	probably damaging	1.00
R4887:Ubr3	UTSW	2	70013131	missense	probably damaging	0.99
R4920:Ubr3	UTSW	2	69952868	missense	probably benign	0.32
R4989:Ubr3	UTSW	2	70020446	splice site	probably benign
R5104:Ubr3	UTSW	2	69938256	missense	probably damaging	0.98
R5134:Ubr3	UTSW	2	70020446	splice site	probably benign
R5137:Ubr3	UTSW	2	69973335	missense	probably damaging	1.00
R5174:Ubr3	UTSW	2	70009162	missense	probably damaging	1.00
R5195:Ubr3	UTSW	2	69956034	missense	probably benign	0.00
R5437:Ubr3	UTSW	2	69944390	missense	probably damaging	1.00
R5539:Ubr3	UTSW	2	70020533	missense	probably damaging	1.00
R5781:Ubr3	UTSW	2	70016244	splice site	probably null
R5809:Ubr3	UTSW	2	69965511	missense	possibly damaging	0.90
R5913:Ubr3	UTSW	2	70021215	missense	probably damaging	1.00
R5969:Ubr3	UTSW	2	69979386	nonsense	probably null
R6136:Ubr3	UTSW	2	69993763	missense	probably benign	0.26
R6140:Ubr3	UTSW	2	69973329	missense	probably benign	0.09
R6185:Ubr3	UTSW	2	69938277	missense	probably damaging	0.98
R6220:Ubr3	UTSW	2	70020475	missense	probably damaging	1.00
R6258:Ubr3	UTSW	2	69982864	splice site	probably null
R6319:Ubr3	UTSW	2	69973414	missense	probably benign	0.00
R6322:Ubr3	UTSW	2	69956085	nonsense	probably null
R6470:Ubr3	UTSW	2	69965460	missense	probably benign	0.02
R6477:Ubr3	UTSW	2	69979429	nonsense	probably null
R6702:Ubr3	UTSW	2	69956049	missense	probably benign	0.23
R6709:Ubr3	UTSW	2	70013092	missense	probably damaging	1.00
R6803:Ubr3	UTSW	2	69936024	critical splice donor site	probably null
R6806:Ubr3	UTSW	2	69955964	splice site	probably benign
R6834:Ubr3	UTSW	2	70000481	missense	possibly damaging	0.63
R6841:Ubr3	UTSW	2	70020625	missense	probably damaging	1.00
R6847:Ubr3	UTSW	2	69983128	missense	probably damaging	1.00
R6889:Ubr3	UTSW	2	69944300	missense	possibly damaging	0.70
R7065:Ubr3	UTSW	2	69953705	missense	probably damaging	1.00
R7102:Ubr3	UTSW	2	69897822	missense	probably damaging	1.00
R7156:Ubr3	UTSW	2	70021623	missense	probably damaging	1.00
R7273:Ubr3	UTSW	2	69979333	missense	probably damaging	0.97
R7314:Ubr3	UTSW	2	69991600	missense	probably damaging	1.00
R7422:Ubr3	UTSW	2	69953542	critical splice donor site	probably null
R7584:Ubr3	UTSW	2	69991503	missense	probably damaging	1.00
R7588:Ubr3	UTSW	2	69971169	missense	probably damaging	1.00
R7597:Ubr3	UTSW	2	69973468	missense	possibly damaging	0.69
R7697:Ubr3	UTSW	2	69897686	missense	probably damaging	1.00
R7737:Ubr3	UTSW	2	69991566	missense	probably benign	0.07
R7743:Ubr3	UTSW	2	69944449	missense	probably benign	0.28
R7946:Ubr3	UTSW	2	69951395	missense	possibly damaging	0.95
R7991:Ubr3	UTSW	2	69952856	missense	probably damaging	1.00
R8071:Ubr3	UTSW	2	69988876	missense	probably damaging	0.99
R8136:Ubr3	UTSW	2	70021179	missense	probably damaging	1.00
R8296:Ubr3	UTSW	2	69954362	missense	probably null	1.00
R8313:Ubr3	UTSW	2	69945134	missense	probably damaging	0.99
Z1088:Ubr3	UTSW	2	69922367	missense	probably benign	0.00
Z1177:Ubr3	UTSW	2	69897461	missense	probably benign	0.17
Z1177:Ubr3	UTSW	2	69897666	missense	probably damaging	1.00
Z1177:Ubr3	UTSW	2	69973206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGTTCTCAGCAGTGGAAG -3'
(R):5'- GCACATGCAGCTTTTCAAATG -3'

Sequencing Primer
(F):5'- CTCAGCAGTGGAAGGTGTG -3'
(R):5'- ATGTTCACTCCTCGTGGCAATAAG -3'

Posted On

2019-06-26