Incidental Mutation 'R7209:S100a6'
ID560922
Institutional Source Beutler Lab
Gene Symbol S100a6
Ensembl Gene ENSMUSG00000001025
Gene NameS100 calcium binding protein A6 (calcyclin)
Synonyms2A9, Cacy, CALCYCLIN, PRA, 5B10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7209 (G1)
Quality Score206.009
Status Validated
Chromosome3
Chromosomal Location90612882-90624181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90613788 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 8 (A8T)
Ref Sequence ENSEMBL: ENSMUSP00000001051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001049] [ENSMUST00000001051] [ENSMUST00000107329] [ENSMUST00000198128] [ENSMUST00000200289]
PDB Structure
Crystal structure of the human RAGE ectodomain (fragment VC1C2) in complex with mouse S100A6 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000001049
SMART Domains Protein: ENSMUSP00000001049
Gene: ENSMUSG00000001023

DomainStartEndE-ValueType
Pfam:S_100 5 43 1.7e-18 PFAM
Blast:EFh 52 80 2e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000001051
AA Change: A8T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001051
Gene: ENSMUSG00000001025
AA Change: A8T

DomainStartEndE-ValueType
Pfam:S_100 5 43 4.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107329
SMART Domains Protein: ENSMUSP00000102952
Gene: ENSMUSG00000001023

DomainStartEndE-ValueType
Pfam:S_100 5 45 6.1e-20 PFAM
Blast:EFh 52 80 2e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000198128
AA Change: A8T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143111
Gene: ENSMUSG00000001025
AA Change: A8T

DomainStartEndE-ValueType
Pfam:S_100 5 44 8.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200289
AA Change: A8T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143720
Gene: ENSMUSG00000001025
AA Change: A8T

DomainStartEndE-ValueType
Pfam:S_100 5 43 4.6e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-dependent insulin release, stimulation of prolactin secretion, and exocytosis. Chromosomal rearrangements and altered expression of this gene have been implicated in melanoma. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,750,357 P1136T probably damaging Het
4933428G20Rik G C 11: 97,492,447 probably null Het
Adam7 A G 14: 68,529,819 Y61H probably damaging Het
Adgrb1 T G 15: 74,569,948 V966G possibly damaging Het
Adh5 G A 3: 138,443,148 probably benign Het
Akr1b8 T C 6: 34,356,272 V28A probably damaging Het
Apbb1 T A 7: 105,566,085 I450F probably damaging Het
Arhgap23 C T 11: 97,476,085 T1064I probably damaging Het
Atg4b A G 1: 93,775,233 I128M probably damaging Het
B230118H07Rik T C 2: 101,566,382 *217W probably null Het
Baat A T 4: 49,503,065 I19N probably damaging Het
Bspry T G 4: 62,486,615 I216S possibly damaging Het
Commd9 T A 2: 101,895,138 S19T possibly damaging Het
Cr2 A G 1: 195,168,724 C145R probably damaging Het
Cyp2c68 A G 19: 39,689,205 L447P probably damaging Het
Depdc1b T C 13: 108,382,855 M333T possibly damaging Het
Dhx9 T C 1: 153,464,623 T710A possibly damaging Het
Dnah5 T C 15: 28,459,225 V4530A possibly damaging Het
Dohh T A 10: 81,386,040 H89Q probably damaging Het
Dopey2 T A 16: 93,769,845 N1171K probably benign Het
Dscam T C 16: 96,650,344 probably null Het
Entpd5 T A 12: 84,396,928 S14C probably benign Het
Eqtn G A 4: 94,925,569 S125F probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fgf18 A T 11: 33,134,315 D46E probably benign Het
Foxa1 T A 12: 57,543,291 M48L probably benign Het
Gabrg1 C A 5: 70,754,170 C417F probably damaging Het
Glrp1 T A 1: 88,503,282 Q122L unknown Het
Gm5286 A T 3: 94,198,705 Q110L probably benign Het
Gm5622 A G 14: 51,655,906 I97V possibly damaging Het
Gusb A G 5: 129,998,546 V306A probably benign Het
Hars A G 18: 36,773,540 S126P probably benign Het
Herc1 A G 9: 66,385,032 S356G possibly damaging Het
Hydin C A 8: 110,489,792 Y1336* probably null Het
Kin T C 2: 10,091,753 Y138H possibly damaging Het
Lypd2 C T 15: 74,732,417 V101M probably benign Het
Madcam1 A T 10: 79,665,058 T70S possibly damaging Het
Man1a2 A G 3: 100,647,079 C112R unknown Het
Mia2 T A 12: 59,154,390 V198E possibly damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Mtif2 G A 11: 29,529,996 V21M probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nln G A 13: 104,072,898 Q56* probably null Het
Nlrp4b T C 7: 10,710,370 V82A probably benign Het
Obscn C A 11: 59,085,107 E2065* probably null Het
Olfr1510 A G 14: 52,410,093 C260R possibly damaging Het
Pilrb2 C T 5: 137,870,864 probably null Het
Plekhh1 C A 12: 79,050,376 D99E probably benign Het
Polr2b T A 5: 77,343,179 F956I probably damaging Het
Ppp3cc A G 14: 70,267,498 F20L probably benign Het
Prmt9 T C 8: 77,564,998 V333A probably benign Het
Psd4 T C 2: 24,397,345 S430P probably damaging Het
Rrp12 A C 19: 41,872,949 V973G possibly damaging Het
Rxfp2 A G 5: 150,053,098 probably null Het
Sgsm2 C A 11: 74,854,325 G717V probably damaging Het
Sipa1 A G 19: 5,654,975 Y531H probably damaging Het
Slc45a1 A C 4: 150,635,212 probably null Het
Srbd1 C A 17: 86,001,520 L743F probably damaging Het
Taar2 A T 10: 23,940,699 I46F possibly damaging Het
Tcrg-C3 A G 13: 19,261,164 N94S probably benign Het
Tmem241 A T 18: 12,104,172 V69D probably damaging Het
Tns1 T C 1: 73,953,915 S535G possibly damaging Het
Ttc34 C A 4: 154,839,128 P98Q probably damaging Het
Ubr1 C A 2: 120,862,765 R1720L probably benign Het
Ubr3 T A 2: 70,016,134 D1597E probably benign Het
Unc79 T C 12: 103,125,624 M1930T probably benign Het
Vmn2r100 A T 17: 19,531,314 I603F not run Het
Vps26b A T 9: 27,009,992 S304T probably benign Het
Zfp952 A T 17: 33,003,470 T308S possibly damaging Het
Other mutations in S100a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4012:S100a6 UTSW 3 90614201 missense probably damaging 0.99
R6045:S100a6 UTSW 3 90613879 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTCACAGATCCCAAAG -3'
(R):5'- CTCCACAGGAAGTAAGATCAGG -3'

Sequencing Primer
(F):5'- GATCCCAAAGCCCCTTCCATTC -3'
(R):5'- GGAACTGTGATTAAATGCCACTCAG -3'
Posted On2019-06-26