Mutagenetix > Incidental Mutations

Incidental Mutation 'R7209:Baat'

560926

Institutional Source

Beutler Lab

Gene Symbol

Baat

Ensembl Gene

ENSMUSG00000039653

Gene Name

bile acid-Coenzyme A: amino acid N-acyltransferase

Synonyms

taurine N-acyltransferase, BAT

MMRRC Submission

Accession Numbers

Genbank: NM_007519; MGI: 106642

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7209 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

49489422-49506557 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 49503065 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 19 (I19N)

Ref Sequence

ENSEMBL: ENSMUSP00000041983 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043056] [ENSMUST00000166036]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043056
AA Change: I19N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041983
Gene: ENSMUSG00000039653
AA Change: I19N

Domain	Start	End	E-Value	Type
Pfam:Bile_Hydr_Trans	13	145	1.7e-44	PFAM
low complexity region	149	162	N/A	INTRINSIC
Pfam:BAAT_C	206	414	8.1e-77	PFAM
Pfam:DLH	285	412	5.5e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000166036
AA Change: I19N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129603
Gene: ENSMUSG00000039653
AA Change: I19N

Domain	Start	End	E-Value	Type
Pfam:Bile_Hydr_Trans	14	144	5.1e-45	PFAM
low complexity region	149	162	N/A	INTRINSIC
Pfam:BAAT_C	206	414	1.2e-77	PFAM

Meta Mutation Damage Score

0.7083

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a liver enzyme that catalyzes the transfer of C24 bile acids from the acyl-CoA thioester to either glycine or taurine, the second step in the formation of bile acid-amino acid conjugates. The bile acid conjugates then act as a detergent in the gastrointestinal tract, which enhances lipid and fat-soluble vitamin absorption. Defects in this gene are a cause of familial hypercholanemia (FHCA). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	A	1: 105,750,357	P1136T	probably damaging	Het
Adam7	A	G	14: 68,529,819	Y61H	probably damaging	Het
Adgrb1	T	G	15: 74,569,948	V966G	possibly damaging	Het
Adh5	G	A	3: 138,443,148		probably benign	Het
Akr1b8	T	C	6: 34,356,272	V28A	probably damaging	Het
Apbb1	T	A	7: 105,566,085	I450F	probably damaging	Het
Arhgap23	G	C	11: 97,492,447		probably null	Het
Arhgap23	C	T	11: 97,476,085	T1064I	probably damaging	Het
Atg4b	A	G	1: 93,775,233	I128M	probably damaging	Het
B230118H07Rik	T	C	2: 101,566,382	*217W	probably null	Het
Bspry	T	G	4: 62,486,615	I216S	possibly damaging	Het
Commd9	T	A	2: 101,895,138	S19T	possibly damaging	Het
Cr2	A	G	1: 195,168,724	C145R	probably damaging	Het
Cyp2c68	A	G	19: 39,689,205	L447P	probably damaging	Het
Depdc1b	T	C	13: 108,382,855	M333T	possibly damaging	Het
Dhx9	T	C	1: 153,464,623	T710A	possibly damaging	Het
Dnah5	T	C	15: 28,459,225	V4530A	possibly damaging	Het
Dohh	T	A	10: 81,386,040	H89Q	probably damaging	Het
Dopey2	T	A	16: 93,769,845	N1171K	probably benign	Het
Dscam	T	C	16: 96,650,344		probably null	Het
Entpd5	T	A	12: 84,396,928	S14C	probably benign	Het
Eqtn	G	A	4: 94,925,569	S125F	probably damaging	Het
Erp44	A	T	4: 48,211,704	D197E	probably benign	Het
Fgf18	A	T	11: 33,134,315	D46E	probably benign	Het
Foxa1	T	A	12: 57,543,291	M48L	probably benign	Het
Gabrg1	C	A	5: 70,754,170	C417F	probably damaging	Het
Glrp1	T	A	1: 88,503,282	Q122L	unknown	Het
Gm5286	A	T	3: 94,198,705	Q110L	probably benign	Het
Gm5622	A	G	14: 51,655,906	I97V	possibly damaging	Het
Gusb	A	G	5: 129,998,546	V306A	probably benign	Het
Hars	A	G	18: 36,773,540	S126P	probably benign	Het
Herc1	A	G	9: 66,385,032	S356G	possibly damaging	Het
Hydin	C	A	8: 110,489,792	Y1336*	probably null	Het
Kin	T	C	2: 10,091,753	Y138H	possibly damaging	Het
Lypd2	C	T	15: 74,732,417	V101M	probably benign	Het
Madcam1	A	T	10: 79,665,058	T70S	possibly damaging	Het
Man1a2	A	G	3: 100,647,079	C112R	unknown	Het
Mia2	T	A	12: 59,154,390	V198E	possibly damaging	Het
Mpdz	C	T	4: 81,306,877	V1438M	possibly damaging	Het
Mtif2	G	A	11: 29,529,996	V21M	probably benign	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nln	G	A	13: 104,072,898	Q56*	probably null	Het
Nlrp4b	T	C	7: 10,710,370	V82A	probably benign	Het
Obscn	C	A	11: 59,085,107	E2065*	probably null	Het
Olfr1510	A	G	14: 52,410,093	C260R	possibly damaging	Het
Pilrb2	C	T	5: 137,870,864		probably null	Het
Plekhh1	C	A	12: 79,050,376	D99E	probably benign	Het
Polr2b	T	A	5: 77,343,179	F956I	probably damaging	Het
Ppp3cc	A	G	14: 70,267,498	F20L	probably benign	Het
Prmt9	T	C	8: 77,564,998	V333A	probably benign	Het
Psd4	T	C	2: 24,397,345	S430P	probably damaging	Het
Rrp12	A	C	19: 41,872,949	V973G	possibly damaging	Het
Rxfp2	A	G	5: 150,053,098		probably null	Het
S100a6	G	A	3: 90,613,788	A8T	possibly damaging	Het
Sgsm2	C	A	11: 74,854,325	G717V	probably damaging	Het
Sipa1	A	G	19: 5,654,975	Y531H	probably damaging	Het
Slc45a1	A	C	4: 150,635,212		probably null	Het
Srbd1	C	A	17: 86,001,520	L743F	probably damaging	Het
Taar2	A	T	10: 23,940,699	I46F	possibly damaging	Het
Tcrg-C3	A	G	13: 19,261,164	N94S	probably benign	Het
Tmem241	A	T	18: 12,104,172	V69D	probably damaging	Het
Tns1	T	C	1: 73,953,915	S535G	possibly damaging	Het
Ttc34	C	A	4: 154,839,128	P98Q	probably damaging	Het
Ubr1	C	A	2: 120,862,765	R1720L	probably benign	Het
Ubr3	T	A	2: 70,016,134	D1597E	probably benign	Het
Unc79	T	C	12: 103,125,624	M1930T	probably benign	Het
Vmn2r100	A	T	17: 19,531,314	I603F	not run	Het
Vps26b	A	T	9: 27,009,992	S304T	probably benign	Het
Zfp952	A	T	17: 33,003,470	T308S	possibly damaging	Het

Other mutations in Baat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Baat	APN	4	49490352	missense	probably damaging	1.00
IGL01124:Baat	APN	4	49490391	missense	possibly damaging	0.82
IGL01327:Baat	APN	4	49490338	missense	probably damaging	1.00
IGL02394:Baat	APN	4	49489812	unclassified	probably benign
IGL03267:Baat	APN	4	49490050	missense	probably benign	0.00
R0085:Baat	UTSW	4	49490425	splice site	probably benign
R1467:Baat	UTSW	4	49503101	missense	probably benign
R1467:Baat	UTSW	4	49503101	missense	probably benign
R1720:Baat	UTSW	4	49490231	missense	probably benign
R2309:Baat	UTSW	4	49499718	missense	probably damaging	1.00
R2992:Baat	UTSW	4	49499675	nonsense	probably null
R4383:Baat	UTSW	4	49499731	missense	probably damaging	1.00
R4602:Baat	UTSW	4	49502727	missense	probably damaging	1.00
R5190:Baat	UTSW	4	49499652	missense	probably damaging	1.00
R5259:Baat	UTSW	4	49490070	missense	probably benign	0.08
R5456:Baat	UTSW	4	49502949	missense	possibly damaging	0.91
R5988:Baat	UTSW	4	49502871	missense	probably damaging	1.00
R6265:Baat	UTSW	4	49502836	missense	possibly damaging	0.94
R7091:Baat	UTSW	4	49499692	missense	probably benign	0.00
R7295:Baat	UTSW	4	49490275	missense	probably damaging	1.00
R7325:Baat	UTSW	4	49490213	missense	probably benign	0.07
R7805:Baat	UTSW	4	49490327	missense	probably benign	0.00
R7867:Baat	UTSW	4	49502925	missense	probably benign	0.44
R7956:Baat	UTSW	4	49490117	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTTTCAGGTTTCAAGGACC -3'
(R):5'- CTGAATCCTGAGAGGTCTGACTC -3'

Sequencing Primer
(F):5'- TTTCAGGTTTCAAGGACCAGAAAAG -3'
(R):5'- AGAGGTCTGACTCTAGTCCTTC -3'

Posted On

2019-06-26