Incidental Mutation 'R7209:Baat'
ID560926
Institutional Source Beutler Lab
Gene Symbol Baat
Ensembl Gene ENSMUSG00000039653
Gene Namebile acid-Coenzyme A: amino acid N-acyltransferase
Synonymstaurine N-acyltransferase, BAT
MMRRC Submission
Accession Numbers

Genbank: NM_007519; MGI: 106642

 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7209 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location49489422-49506557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49503065 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 19 (I19N)
Ref Sequence ENSEMBL: ENSMUSP00000041983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043056] [ENSMUST00000166036]
Predicted Effect probably damaging
Transcript: ENSMUST00000043056
AA Change: I19N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041983
Gene: ENSMUSG00000039653
AA Change: I19N

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 13 145 1.7e-44 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:BAAT_C 206 414 8.1e-77 PFAM
Pfam:DLH 285 412 5.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166036
AA Change: I19N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129603
Gene: ENSMUSG00000039653
AA Change: I19N

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 144 5.1e-45 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:BAAT_C 206 414 1.2e-77 PFAM
Meta Mutation Damage Score 0.7083 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a liver enzyme that catalyzes the transfer of C24 bile acids from the acyl-CoA thioester to either glycine or taurine, the second step in the formation of bile acid-amino acid conjugates. The bile acid conjugates then act as a detergent in the gastrointestinal tract, which enhances lipid and fat-soluble vitamin absorption. Defects in this gene are a cause of familial hypercholanemia (FHCA). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,750,357 P1136T probably damaging Het
Adam7 A G 14: 68,529,819 Y61H probably damaging Het
Adgrb1 T G 15: 74,569,948 V966G possibly damaging Het
Adh5 G A 3: 138,443,148 probably benign Het
Akr1b8 T C 6: 34,356,272 V28A probably damaging Het
Apbb1 T A 7: 105,566,085 I450F probably damaging Het
Arhgap23 G C 11: 97,492,447 probably null Het
Arhgap23 C T 11: 97,476,085 T1064I probably damaging Het
Atg4b A G 1: 93,775,233 I128M probably damaging Het
B230118H07Rik T C 2: 101,566,382 *217W probably null Het
Bspry T G 4: 62,486,615 I216S possibly damaging Het
Commd9 T A 2: 101,895,138 S19T possibly damaging Het
Cr2 A G 1: 195,168,724 C145R probably damaging Het
Cyp2c68 A G 19: 39,689,205 L447P probably damaging Het
Depdc1b T C 13: 108,382,855 M333T possibly damaging Het
Dhx9 T C 1: 153,464,623 T710A possibly damaging Het
Dnah5 T C 15: 28,459,225 V4530A possibly damaging Het
Dohh T A 10: 81,386,040 H89Q probably damaging Het
Dopey2 T A 16: 93,769,845 N1171K probably benign Het
Dscam T C 16: 96,650,344 probably null Het
Entpd5 T A 12: 84,396,928 S14C probably benign Het
Eqtn G A 4: 94,925,569 S125F probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fgf18 A T 11: 33,134,315 D46E probably benign Het
Foxa1 T A 12: 57,543,291 M48L probably benign Het
Gabrg1 C A 5: 70,754,170 C417F probably damaging Het
Glrp1 T A 1: 88,503,282 Q122L unknown Het
Gm5286 A T 3: 94,198,705 Q110L probably benign Het
Gm5622 A G 14: 51,655,906 I97V possibly damaging Het
Gusb A G 5: 129,998,546 V306A probably benign Het
Hars A G 18: 36,773,540 S126P probably benign Het
Herc1 A G 9: 66,385,032 S356G possibly damaging Het
Hydin C A 8: 110,489,792 Y1336* probably null Het
Kin T C 2: 10,091,753 Y138H possibly damaging Het
Lypd2 C T 15: 74,732,417 V101M probably benign Het
Madcam1 A T 10: 79,665,058 T70S possibly damaging Het
Man1a2 A G 3: 100,647,079 C112R unknown Het
Mia2 T A 12: 59,154,390 V198E possibly damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Mtif2 G A 11: 29,529,996 V21M probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nln G A 13: 104,072,898 Q56* probably null Het
Nlrp4b T C 7: 10,710,370 V82A probably benign Het
Obscn C A 11: 59,085,107 E2065* probably null Het
Olfr1510 A G 14: 52,410,093 C260R possibly damaging Het
Pilrb2 C T 5: 137,870,864 probably null Het
Plekhh1 C A 12: 79,050,376 D99E probably benign Het
Polr2b T A 5: 77,343,179 F956I probably damaging Het
Ppp3cc A G 14: 70,267,498 F20L probably benign Het
Prmt9 T C 8: 77,564,998 V333A probably benign Het
Psd4 T C 2: 24,397,345 S430P probably damaging Het
Rrp12 A C 19: 41,872,949 V973G possibly damaging Het
Rxfp2 A G 5: 150,053,098 probably null Het
S100a6 G A 3: 90,613,788 A8T possibly damaging Het
Sgsm2 C A 11: 74,854,325 G717V probably damaging Het
Sipa1 A G 19: 5,654,975 Y531H probably damaging Het
Slc45a1 A C 4: 150,635,212 probably null Het
Srbd1 C A 17: 86,001,520 L743F probably damaging Het
Taar2 A T 10: 23,940,699 I46F possibly damaging Het
Tcrg-C3 A G 13: 19,261,164 N94S probably benign Het
Tmem241 A T 18: 12,104,172 V69D probably damaging Het
Tns1 T C 1: 73,953,915 S535G possibly damaging Het
Ttc34 C A 4: 154,839,128 P98Q probably damaging Het
Ubr1 C A 2: 120,862,765 R1720L probably benign Het
Ubr3 T A 2: 70,016,134 D1597E probably benign Het
Unc79 T C 12: 103,125,624 M1930T probably benign Het
Vmn2r100 A T 17: 19,531,314 I603F not run Het
Vps26b A T 9: 27,009,992 S304T probably benign Het
Zfp952 A T 17: 33,003,470 T308S possibly damaging Het
Other mutations in Baat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Baat APN 4 49490352 missense probably damaging 1.00
IGL01124:Baat APN 4 49490391 missense possibly damaging 0.82
IGL01327:Baat APN 4 49490338 missense probably damaging 1.00
IGL02394:Baat APN 4 49489812 unclassified probably benign
IGL03267:Baat APN 4 49490050 missense probably benign 0.00
R0085:Baat UTSW 4 49490425 splice site probably benign
R1467:Baat UTSW 4 49503101 missense probably benign
R1467:Baat UTSW 4 49503101 missense probably benign
R1720:Baat UTSW 4 49490231 missense probably benign
R2309:Baat UTSW 4 49499718 missense probably damaging 1.00
R2992:Baat UTSW 4 49499675 nonsense probably null
R4383:Baat UTSW 4 49499731 missense probably damaging 1.00
R4602:Baat UTSW 4 49502727 missense probably damaging 1.00
R5190:Baat UTSW 4 49499652 missense probably damaging 1.00
R5259:Baat UTSW 4 49490070 missense probably benign 0.08
R5456:Baat UTSW 4 49502949 missense possibly damaging 0.91
R5988:Baat UTSW 4 49502871 missense probably damaging 1.00
R6265:Baat UTSW 4 49502836 missense possibly damaging 0.94
R7091:Baat UTSW 4 49499692 missense probably benign 0.00
R7295:Baat UTSW 4 49490275 missense probably damaging 1.00
R7325:Baat UTSW 4 49490213 missense probably benign 0.07
R7805:Baat UTSW 4 49490327 missense probably benign 0.00
R7867:Baat UTSW 4 49502925 missense probably benign 0.44
R7956:Baat UTSW 4 49490117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTTCAGGTTTCAAGGACC -3'
(R):5'- CTGAATCCTGAGAGGTCTGACTC -3'

Sequencing Primer
(F):5'- TTTCAGGTTTCAAGGACCAGAAAAG -3'
(R):5'- AGAGGTCTGACTCTAGTCCTTC -3'
Posted On2019-06-26