Incidental Mutation 'R7209:Gusb'
ID560933
Institutional Source Beutler Lab
Gene Symbol Gusb
Ensembl Gene ENSMUSG00000025534
Gene Nameglucuronidase, beta
SynonymsGut, Gus, asd, Gur, g, Gus-s, Gus-r, adipose storage deficiency, Gus-u, Gus-t
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7209 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location129989011-130003049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129998546 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 306 (V306A)
Ref Sequence ENSEMBL: ENSMUSP00000026613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026613] [ENSMUST00000111307] [ENSMUST00000111308] [ENSMUST00000201801]
Predicted Effect probably benign
Transcript: ENSMUST00000026613
AA Change: V306A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026613
Gene: ENSMUSG00000025534
AA Change: V306A

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 223 4e-46 PFAM
Pfam:Glyco_hydro_2 225 323 6.4e-12 PFAM
Pfam:Glyco_hydro_2_C 325 627 9e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111307
SMART Domains Protein: ENSMUSP00000106939
Gene: ENSMUSG00000025534

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 143 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111308
SMART Domains Protein: ENSMUSP00000106940
Gene: ENSMUSG00000025534

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 223 7.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201801
SMART Domains Protein: ENSMUSP00000144478
Gene: ENSMUSG00000025534

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 138 5.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hydrolase that degrades glycosaminoglycans, including heparan sulfate, dermatan sulfate, and chondroitin-4,6-sulfate. The enzyme forms a homotetramer that is localized to the lysosome. Mutations in this gene result in mucopolysaccharidosis type VII. Alternative splicing results in multiple transcript variants. There are many pseudogenes of this locus in the human genome.[provided by RefSeq, May 2014]
PHENOTYPE: Knock-in mutations of this gene lead to lysosomal storage disease and may cause premature death, facial, tail and limb anomalies, growth retardation, male sterility, reduced lactation, osteosclerosis and behavioral defects. Additional phenotypes include partial neonatal death and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,750,357 P1136T probably damaging Het
Adam7 A G 14: 68,529,819 Y61H probably damaging Het
Adgrb1 T G 15: 74,569,948 V966G possibly damaging Het
Adh5 G A 3: 138,443,148 probably benign Het
Akr1b8 T C 6: 34,356,272 V28A probably damaging Het
Apbb1 T A 7: 105,566,085 I450F probably damaging Het
Arhgap23 G C 11: 97,492,447 probably null Het
Arhgap23 C T 11: 97,476,085 T1064I probably damaging Het
Atg4b A G 1: 93,775,233 I128M probably damaging Het
B230118H07Rik T C 2: 101,566,382 *217W probably null Het
Baat A T 4: 49,503,065 I19N probably damaging Het
Bspry T G 4: 62,486,615 I216S possibly damaging Het
Commd9 T A 2: 101,895,138 S19T possibly damaging Het
Cr2 A G 1: 195,168,724 C145R probably damaging Het
Cyp2c68 A G 19: 39,689,205 L447P probably damaging Het
Depdc1b T C 13: 108,382,855 M333T possibly damaging Het
Dhx9 T C 1: 153,464,623 T710A possibly damaging Het
Dnah5 T C 15: 28,459,225 V4530A possibly damaging Het
Dohh T A 10: 81,386,040 H89Q probably damaging Het
Dopey2 T A 16: 93,769,845 N1171K probably benign Het
Dscam T C 16: 96,650,344 probably null Het
Entpd5 T A 12: 84,396,928 S14C probably benign Het
Eqtn G A 4: 94,925,569 S125F probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fgf18 A T 11: 33,134,315 D46E probably benign Het
Foxa1 T A 12: 57,543,291 M48L probably benign Het
Gabrg1 C A 5: 70,754,170 C417F probably damaging Het
Glrp1 T A 1: 88,503,282 Q122L unknown Het
Gm5286 A T 3: 94,198,705 Q110L probably benign Het
Gm5622 A G 14: 51,655,906 I97V possibly damaging Het
Hars A G 18: 36,773,540 S126P probably benign Het
Herc1 A G 9: 66,385,032 S356G possibly damaging Het
Hydin C A 8: 110,489,792 Y1336* probably null Het
Kin T C 2: 10,091,753 Y138H possibly damaging Het
Lypd2 C T 15: 74,732,417 V101M probably benign Het
Madcam1 A T 10: 79,665,058 T70S possibly damaging Het
Man1a2 A G 3: 100,647,079 C112R unknown Het
Mia2 T A 12: 59,154,390 V198E possibly damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Mtif2 G A 11: 29,529,996 V21M probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nln G A 13: 104,072,898 Q56* probably null Het
Nlrp4b T C 7: 10,710,370 V82A probably benign Het
Obscn C A 11: 59,085,107 E2065* probably null Het
Olfr1510 A G 14: 52,410,093 C260R possibly damaging Het
Pilrb2 C T 5: 137,870,864 probably null Het
Plekhh1 C A 12: 79,050,376 D99E probably benign Het
Polr2b T A 5: 77,343,179 F956I probably damaging Het
Ppp3cc A G 14: 70,267,498 F20L probably benign Het
Prmt9 T C 8: 77,564,998 V333A probably benign Het
Psd4 T C 2: 24,397,345 S430P probably damaging Het
Rrp12 A C 19: 41,872,949 V973G possibly damaging Het
Rxfp2 A G 5: 150,053,098 probably null Het
S100a6 G A 3: 90,613,788 A8T possibly damaging Het
Sgsm2 C A 11: 74,854,325 G717V probably damaging Het
Sipa1 A G 19: 5,654,975 Y531H probably damaging Het
Slc45a1 A C 4: 150,635,212 probably null Het
Srbd1 C A 17: 86,001,520 L743F probably damaging Het
Taar2 A T 10: 23,940,699 I46F possibly damaging Het
Tcrg-C3 A G 13: 19,261,164 N94S probably benign Het
Tmem241 A T 18: 12,104,172 V69D probably damaging Het
Tns1 T C 1: 73,953,915 S535G possibly damaging Het
Ttc34 C A 4: 154,839,128 P98Q probably damaging Het
Ubr1 C A 2: 120,862,765 R1720L probably benign Het
Ubr3 T A 2: 70,016,134 D1597E probably benign Het
Unc79 T C 12: 103,125,624 M1930T probably benign Het
Vmn2r100 A T 17: 19,531,314 I603F not run Het
Vps26b A T 9: 27,009,992 S304T probably benign Het
Zfp952 A T 17: 33,003,470 T308S possibly damaging Het
Other mutations in Gusb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gusb APN 5 129999381 missense probably damaging 1.00
IGL01561:Gusb APN 5 129998086 missense probably damaging 1.00
IGL02642:Gusb APN 5 130000535 splice site probably null
IGL03307:Gusb APN 5 130000031 makesense probably null
R0389:Gusb UTSW 5 129998086 missense probably damaging 1.00
R1496:Gusb UTSW 5 129998544 missense probably benign 0.00
R1512:Gusb UTSW 5 130000890 missense probably damaging 1.00
R2125:Gusb UTSW 5 129999447 missense probably benign 0.00
R2888:Gusb UTSW 5 130000502 missense probably damaging 1.00
R2890:Gusb UTSW 5 130000502 missense probably damaging 1.00
R3017:Gusb UTSW 5 130000484 missense probably damaging 1.00
R4453:Gusb UTSW 5 129998483 missense possibly damaging 0.84
R4906:Gusb UTSW 5 129998118 missense probably damaging 0.98
R4937:Gusb UTSW 5 129995485 missense probably damaging 0.99
R5260:Gusb UTSW 5 129999988 nonsense probably null
R5281:Gusb UTSW 5 129998526 missense probably benign 0.00
R6194:Gusb UTSW 5 129990065 missense possibly damaging 0.46
R6248:Gusb UTSW 5 130000525 missense probably benign 0.01
R7121:Gusb UTSW 5 130000043 missense probably benign 0.44
R7768:Gusb UTSW 5 130000405 missense probably benign 0.01
R8223:Gusb UTSW 5 129990112 missense probably benign 0.00
Z1177:Gusb UTSW 5 130002736 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCCACACATTGATGCCACAG -3'
(R):5'- TTGTGGGATACGTAGGCACC -3'

Sequencing Primer
(F):5'- ATTGATGCCACAGCTCCTAC -3'
(R):5'- GATCTCTATAAGTTGGAGCCAGCC -3'
Posted On2019-06-26