Mutagenetix > Incidental Mutations

Incidental Mutation 'R7209:Nln'

560956

Institutional Source

Beutler Lab

Gene Symbol

Nln

Ensembl Gene

ENSMUSG00000021710

Gene Name

neurolysin (metallopeptidase M3 family)

Synonyms

4930472G13Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.129) question?

Stock #

R7209 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104023057-104109614 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 104072898 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 56 (Q56*)

Ref Sequence

ENSEMBL: ENSMUSP00000104938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109315] [ENSMUST00000224945]

Predicted Effect

probably null
Transcript: ENSMUST00000109315
AA Change: Q56*

SMART Domains

Protein: ENSMUSP00000104938
Gene: ENSMUSG00000021710
AA Change: Q56*

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M3	251	701	1.8e-158	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000224945
AA Change: Q56*

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the metallopeptidase M3 protein family that cleaves neurotensin at the Pro10-Tyr11 bond, leading to the formation of neurotensin(1-10) and neurotensin(11-13). The encoded protein is likely involved in the termination of the neurotensinergic signal in the central nervous system and in the gastrointestinal tract.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit increased glucose tolerance, insulin sensitivity, and gluconeogensis. Mice also show decreased body weight and run less in a low intensity regime to exhaustion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	A	1: 105,750,357	P1136T	probably damaging	Het
Adam7	A	G	14: 68,529,819	Y61H	probably damaging	Het
Adgrb1	T	G	15: 74,569,948	V966G	possibly damaging	Het
Adh5	G	A	3: 138,443,148		probably benign	Het
Akr1b8	T	C	6: 34,356,272	V28A	probably damaging	Het
Apbb1	T	A	7: 105,566,085	I450F	probably damaging	Het
Arhgap23	G	C	11: 97,492,447		probably null	Het
Arhgap23	C	T	11: 97,476,085	T1064I	probably damaging	Het
Atg4b	A	G	1: 93,775,233	I128M	probably damaging	Het
B230118H07Rik	T	C	2: 101,566,382	*217W	probably null	Het
Baat	A	T	4: 49,503,065	I19N	probably damaging	Het
Bspry	T	G	4: 62,486,615	I216S	possibly damaging	Het
Commd9	T	A	2: 101,895,138	S19T	possibly damaging	Het
Cr2	A	G	1: 195,168,724	C145R	probably damaging	Het
Cyp2c68	A	G	19: 39,689,205	L447P	probably damaging	Het
Depdc1b	T	C	13: 108,382,855	M333T	possibly damaging	Het
Dhx9	T	C	1: 153,464,623	T710A	possibly damaging	Het
Dnah5	T	C	15: 28,459,225	V4530A	possibly damaging	Het
Dohh	T	A	10: 81,386,040	H89Q	probably damaging	Het
Dopey2	T	A	16: 93,769,845	N1171K	probably benign	Het
Dscam	T	C	16: 96,650,344		probably null	Het
Entpd5	T	A	12: 84,396,928	S14C	probably benign	Het
Eqtn	G	A	4: 94,925,569	S125F	probably damaging	Het
Erp44	A	T	4: 48,211,704	D197E	probably benign	Het
Fgf18	A	T	11: 33,134,315	D46E	probably benign	Het
Foxa1	T	A	12: 57,543,291	M48L	probably benign	Het
Gabrg1	C	A	5: 70,754,170	C417F	probably damaging	Het
Glrp1	T	A	1: 88,503,282	Q122L	unknown	Het
Gm5286	A	T	3: 94,198,705	Q110L	probably benign	Het
Gm5622	A	G	14: 51,655,906	I97V	possibly damaging	Het
Gusb	A	G	5: 129,998,546	V306A	probably benign	Het
Hars	A	G	18: 36,773,540	S126P	probably benign	Het
Herc1	A	G	9: 66,385,032	S356G	possibly damaging	Het
Hydin	C	A	8: 110,489,792	Y1336*	probably null	Het
Kin	T	C	2: 10,091,753	Y138H	possibly damaging	Het
Lypd2	C	T	15: 74,732,417	V101M	probably benign	Het
Madcam1	A	T	10: 79,665,058	T70S	possibly damaging	Het
Man1a2	A	G	3: 100,647,079	C112R	unknown	Het
Mia2	T	A	12: 59,154,390	V198E	possibly damaging	Het
Mpdz	C	T	4: 81,306,877	V1438M	possibly damaging	Het
Mtif2	G	A	11: 29,529,996	V21M	probably benign	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nlrp4b	T	C	7: 10,710,370	V82A	probably benign	Het
Obscn	C	A	11: 59,085,107	E2065*	probably null	Het
Olfr1510	A	G	14: 52,410,093	C260R	possibly damaging	Het
Pilrb2	C	T	5: 137,870,864		probably null	Het
Plekhh1	C	A	12: 79,050,376	D99E	probably benign	Het
Polr2b	T	A	5: 77,343,179	F956I	probably damaging	Het
Ppp3cc	A	G	14: 70,267,498	F20L	probably benign	Het
Prmt9	T	C	8: 77,564,998	V333A	probably benign	Het
Psd4	T	C	2: 24,397,345	S430P	probably damaging	Het
Rrp12	A	C	19: 41,872,949	V973G	possibly damaging	Het
Rxfp2	A	G	5: 150,053,098		probably null	Het
S100a6	G	A	3: 90,613,788	A8T	possibly damaging	Het
Sgsm2	C	A	11: 74,854,325	G717V	probably damaging	Het
Sipa1	A	G	19: 5,654,975	Y531H	probably damaging	Het
Slc45a1	A	C	4: 150,635,212		probably null	Het
Srbd1	C	A	17: 86,001,520	L743F	probably damaging	Het
Taar2	A	T	10: 23,940,699	I46F	possibly damaging	Het
Tcrg-C3	A	G	13: 19,261,164	N94S	probably benign	Het
Tmem241	A	T	18: 12,104,172	V69D	probably damaging	Het
Tns1	T	C	1: 73,953,915	S535G	possibly damaging	Het
Ttc34	C	A	4: 154,839,128	P98Q	probably damaging	Het
Ubr1	C	A	2: 120,862,765	R1720L	probably benign	Het
Ubr3	T	A	2: 70,016,134	D1597E	probably benign	Het
Unc79	T	C	12: 103,125,624	M1930T	probably benign	Het
Vmn2r100	A	T	17: 19,531,314	I603F	not run	Het
Vps26b	A	T	9: 27,009,992	S304T	probably benign	Het
Zfp952	A	T	17: 33,003,470	T308S	possibly damaging	Het

Other mutations in Nln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Nln	APN	13	104035645	missense	probably damaging	1.00
IGL01656:Nln	APN	13	104061741	splice site	probably null
R0025:Nln	UTSW	13	104036891	missense	probably damaging	0.98
R0294:Nln	UTSW	13	104052579	missense	probably damaging	1.00
R1396:Nln	UTSW	13	104061753	missense	probably benign	0.01
R1657:Nln	UTSW	13	104036947	missense	possibly damaging	0.94
R2087:Nln	UTSW	13	104037369	missense	probably damaging	0.96
R2847:Nln	UTSW	13	104025025	missense	probably damaging	1.00
R3034:Nln	UTSW	13	104037439	missense	possibly damaging	0.91
R5576:Nln	UTSW	13	104058830	missense	probably damaging	1.00
R5585:Nln	UTSW	13	104025061	missense	possibly damaging	0.73
R5882:Nln	UTSW	13	104059498	missense	probably benign	0.08
R6763:Nln	UTSW	13	104035655	missense	probably damaging	1.00
R7347:Nln	UTSW	13	104050847	missense	probably damaging	0.96
R7417:Nln	UTSW	13	104036970	missense	probably damaging	1.00
R7467:Nln	UTSW	13	104025022	missense	possibly damaging	0.75
R7491:Nln	UTSW	13	104069323	missense	probably damaging	1.00
R7553:Nln	UTSW	13	104050416	frame shift	probably null
R7842:Nln	UTSW	13	104052629	missense	probably benign
X0020:Nln	UTSW	13	104061810	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGAAATACTGAGACGCTCC -3'
(R):5'- TGAAACATTCTTACTTGGTGTCGG -3'

Sequencing Primer
(F):5'- CCGTCTGCACCCACCTATGTAC -3'
(R):5'- TTTTAGCTCCCAGCCAACAG -3'

Posted On

2019-06-26