Incidental Mutation 'R7209:Ppp3cc'
ID560961
Institutional Source Beutler Lab
Gene Symbol Ppp3cc
Ensembl Gene ENSMUSG00000022092
Gene Nameprotein phosphatase 3, catalytic subunit, gamma isoform
SynonymsCalnc, PP2BA gamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7209 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70217865-70289471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70267498 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 20 (F20L)
Ref Sequence ENSEMBL: ENSMUSP00000077532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078434] [ENSMUST00000228911]
Predicted Effect probably benign
Transcript: ENSMUST00000078434
AA Change: F20L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077532
Gene: ENSMUSG00000022092
AA Change: F20L

DomainStartEndE-ValueType
PP2Ac 52 343 4e-151 SMART
low complexity region 413 433 N/A INTRINSIC
low complexity region 492 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228911
AA Change: F20L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin is a calcium-dependent, calmodulin-stimulated protein phosphatase involved in the downstream regulation of dopaminergic signal transduction. Calcineurin is composed of a regulatory subunit and a catalytic subunit. The protein encoded by this gene represents one of the regulatory subunits that has been found for calcineurin. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to reduced hyperactivated sperm motility and midpiece rigidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,750,357 P1136T probably damaging Het
Adam7 A G 14: 68,529,819 Y61H probably damaging Het
Adgrb1 T G 15: 74,569,948 V966G possibly damaging Het
Adh5 G A 3: 138,443,148 probably benign Het
Akr1b8 T C 6: 34,356,272 V28A probably damaging Het
Apbb1 T A 7: 105,566,085 I450F probably damaging Het
Arhgap23 G C 11: 97,492,447 probably null Het
Arhgap23 C T 11: 97,476,085 T1064I probably damaging Het
Atg4b A G 1: 93,775,233 I128M probably damaging Het
B230118H07Rik T C 2: 101,566,382 *217W probably null Het
Baat A T 4: 49,503,065 I19N probably damaging Het
Bspry T G 4: 62,486,615 I216S possibly damaging Het
Commd9 T A 2: 101,895,138 S19T possibly damaging Het
Cr2 A G 1: 195,168,724 C145R probably damaging Het
Cyp2c68 A G 19: 39,689,205 L447P probably damaging Het
Depdc1b T C 13: 108,382,855 M333T possibly damaging Het
Dhx9 T C 1: 153,464,623 T710A possibly damaging Het
Dnah5 T C 15: 28,459,225 V4530A possibly damaging Het
Dohh T A 10: 81,386,040 H89Q probably damaging Het
Dopey2 T A 16: 93,769,845 N1171K probably benign Het
Dscam T C 16: 96,650,344 probably null Het
Entpd5 T A 12: 84,396,928 S14C probably benign Het
Eqtn G A 4: 94,925,569 S125F probably damaging Het
Erp44 A T 4: 48,211,704 D197E probably benign Het
Fgf18 A T 11: 33,134,315 D46E probably benign Het
Foxa1 T A 12: 57,543,291 M48L probably benign Het
Gabrg1 C A 5: 70,754,170 C417F probably damaging Het
Glrp1 T A 1: 88,503,282 Q122L unknown Het
Gm5286 A T 3: 94,198,705 Q110L probably benign Het
Gm5622 A G 14: 51,655,906 I97V possibly damaging Het
Gusb A G 5: 129,998,546 V306A probably benign Het
Hars A G 18: 36,773,540 S126P probably benign Het
Herc1 A G 9: 66,385,032 S356G possibly damaging Het
Hydin C A 8: 110,489,792 Y1336* probably null Het
Kin T C 2: 10,091,753 Y138H possibly damaging Het
Lypd2 C T 15: 74,732,417 V101M probably benign Het
Madcam1 A T 10: 79,665,058 T70S possibly damaging Het
Man1a2 A G 3: 100,647,079 C112R unknown Het
Mia2 T A 12: 59,154,390 V198E possibly damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Mtif2 G A 11: 29,529,996 V21M probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nln G A 13: 104,072,898 Q56* probably null Het
Nlrp4b T C 7: 10,710,370 V82A probably benign Het
Obscn C A 11: 59,085,107 E2065* probably null Het
Olfr1510 A G 14: 52,410,093 C260R possibly damaging Het
Pilrb2 C T 5: 137,870,864 probably null Het
Plekhh1 C A 12: 79,050,376 D99E probably benign Het
Polr2b T A 5: 77,343,179 F956I probably damaging Het
Prmt9 T C 8: 77,564,998 V333A probably benign Het
Psd4 T C 2: 24,397,345 S430P probably damaging Het
Rrp12 A C 19: 41,872,949 V973G possibly damaging Het
Rxfp2 A G 5: 150,053,098 probably null Het
S100a6 G A 3: 90,613,788 A8T possibly damaging Het
Sgsm2 C A 11: 74,854,325 G717V probably damaging Het
Sipa1 A G 19: 5,654,975 Y531H probably damaging Het
Slc45a1 A C 4: 150,635,212 probably null Het
Srbd1 C A 17: 86,001,520 L743F probably damaging Het
Taar2 A T 10: 23,940,699 I46F possibly damaging Het
Tcrg-C3 A G 13: 19,261,164 N94S probably benign Het
Tmem241 A T 18: 12,104,172 V69D probably damaging Het
Tns1 T C 1: 73,953,915 S535G possibly damaging Het
Ttc34 C A 4: 154,839,128 P98Q probably damaging Het
Ubr1 C A 2: 120,862,765 R1720L probably benign Het
Ubr3 T A 2: 70,016,134 D1597E probably benign Het
Unc79 T C 12: 103,125,624 M1930T probably benign Het
Vmn2r100 A T 17: 19,531,314 I603F not run Het
Vps26b A T 9: 27,009,992 S304T probably benign Het
Zfp952 A T 17: 33,003,470 T308S possibly damaging Het
Other mutations in Ppp3cc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Ppp3cc APN 14 70218252 missense probably damaging 0.99
IGL02182:Ppp3cc APN 14 70225024 missense probably benign 0.21
IGL02272:Ppp3cc APN 14 70236489 missense probably damaging 1.00
IGL03207:Ppp3cc APN 14 70247582 missense probably damaging 1.00
IGL03394:Ppp3cc APN 14 70225028 nonsense probably null
tomap UTSW 14 70240948 missense probably damaging 1.00
R0111:Ppp3cc UTSW 14 70256359 critical splice donor site probably null
R0625:Ppp3cc UTSW 14 70225027 missense probably damaging 0.99
R1368:Ppp3cc UTSW 14 70245862 missense probably damaging 1.00
R1484:Ppp3cc UTSW 14 70240948 missense probably damaging 1.00
R4757:Ppp3cc UTSW 14 70218186 missense possibly damaging 0.94
R6198:Ppp3cc UTSW 14 70247611 missense probably benign 0.20
R7042:Ppp3cc UTSW 14 70225019 missense probably benign 0.14
R7305:Ppp3cc UTSW 14 70240803 missense probably benign
R7406:Ppp3cc UTSW 14 70245938 missense possibly damaging 0.80
R7509:Ppp3cc UTSW 14 70266682 missense probably damaging 1.00
R7623:Ppp3cc UTSW 14 70240945 missense probably benign 0.37
R7814:Ppp3cc UTSW 14 70225015 missense possibly damaging 0.68
RF002:Ppp3cc UTSW 14 70267339 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AGCCTCCACCTCTATCATGG -3'
(R):5'- GTGGATGTAGTCATGAATGTACAGAC -3'

Sequencing Primer
(F):5'- ATCATGGTCTTCTCCTGCTTCAG -3'
(R):5'- GTAGTCATGAATGTACAGACAACCAC -3'
Posted On2019-06-26