Incidental Mutation 'R0594:Lmbr1'
ID56097
Institutional Source Beutler Lab
Gene Symbol Lmbr1
Ensembl Gene ENSMUSG00000010721
Gene Namelimb region 1
Synonyms1110048D14Rik
MMRRC Submission 038784-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0594 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location29229802-29378390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29292209 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 65 (F65L)
Ref Sequence ENSEMBL: ENSMUSP00000143316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055195] [ENSMUST00000179191] [ENSMUST00000196321] [ENSMUST00000198105] [ENSMUST00000200564]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055195
AA Change: F188L

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058405
Gene: ENSMUSG00000010721
AA Change: F188L

DomainStartEndE-ValueType
Pfam:LMBR1 26 281 3.5e-46 PFAM
Pfam:LMBR1 239 445 1.7e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179191
AA Change: F160L

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136160
Gene: ENSMUSG00000010721
AA Change: F160L

DomainStartEndE-ValueType
Pfam:LMBR1 23 108 6e-31 PFAM
Pfam:LMBR1 106 418 5.3e-99 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196321
AA Change: F65L

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143348
Gene: ENSMUSG00000010721
AA Change: F65L

DomainStartEndE-ValueType
Pfam:LMBR1 1 323 4e-106 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000198105
AA Change: F161L

PolyPhen 2 Score 0.706 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142755
Gene: ENSMUSG00000010721
AA Change: F161L

DomainStartEndE-ValueType
Pfam:LMBR1 23 107 5.4e-30 PFAM
Pfam:LMBR1 106 419 3.4e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198367
Predicted Effect unknown
Transcript: ENSMUST00000200149
AA Change: F2L
Predicted Effect possibly damaging
Transcript: ENSMUST00000200564
AA Change: F65L

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143316
Gene: ENSMUSG00000010721
AA Change: F65L

DomainStartEndE-ValueType
Pfam:LMBR1 1 310 8.6e-92 PFAM
Meta Mutation Damage Score 0.1163 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 99% (119/120)
MGI Phenotype FUNCTION: This gene encodes a member of the LMBR1-like membrane protein family. Another member of this protein family has been shown to be a lipocalin transmembrane receptor. A highly conserved, cis-acting regulatory module for the sonic hedgehog gene is located within an intron of this gene. Consequently, disruption of this genic region can alter sonic hedgehog expression and affect limb patterning, but it is not known if this gene functions directly in limb development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show minor coalitions of distal wrist bones and a low incidence of limb defects, including oligodactyly, brachyphalangia, and soft tissue or bony syndactyly. Homozygotes for another null allele exhibit normal morphology,clinical chemistry, hematology and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,389,880 V41A probably benign Het
Acad11 A G 9: 104,095,563 Q367R probably benign Het
Ackr4 A G 9: 104,099,004 V248A possibly damaging Het
Adamts14 T C 10: 61,202,887 E945G probably damaging Het
Akap2 A G 4: 57,856,752 T694A probably benign Het
Ano2 A G 6: 125,982,765 M663V probably damaging Het
Apc2 T A 10: 80,306,256 C336* probably null Het
Arhgap17 A G 7: 123,294,518 S560P probably benign Het
Arl5a T C 2: 52,405,014 D128G probably damaging Het
Atp6v0a2 C A 5: 124,717,982 R678S probably benign Het
B4galnt2 C A 11: 95,891,909 A26S probably benign Het
C1qtnf1 A T 11: 118,446,628 T95S possibly damaging Het
Ccdc188 T A 16: 18,218,920 F241L probably benign Het
Cdh19 A T 1: 110,925,867 D281E probably benign Het
Cdk5rap2 T C 4: 70,354,813 E241G probably damaging Het
Cherp A T 8: 72,462,402 probably null Het
Cpne9 T A 6: 113,290,400 probably benign Het
Cthrc1 A T 15: 39,077,142 R47W possibly damaging Het
Dcaf13 A G 15: 39,123,268 E145G probably benign Het
Dcaf4 T A 12: 83,538,043 probably null Het
Dgka A C 10: 128,733,110 probably benign Het
Dhrs13 T A 11: 78,034,525 F157L probably damaging Het
Dnajb5 A T 4: 42,956,577 Y88F probably damaging Het
Dpp8 A G 9: 65,036,998 T16A probably damaging Het
Dscc1 A T 15: 55,089,052 I91K possibly damaging Het
Efemp2 T A 19: 5,475,063 probably benign Het
Elf2 T C 3: 51,256,453 T504A possibly damaging Het
Elk3 G A 10: 93,265,160 S243F probably damaging Het
Ell2 A G 13: 75,749,993 D93G probably damaging Het
Eln G T 5: 134,712,398 probably benign Het
Eme1 C T 11: 94,650,430 D189N possibly damaging Het
Epb41l2 A G 10: 25,443,770 E167G possibly damaging Het
Exoc5 A T 14: 49,036,087 probably benign Het
Fam129c C A 8: 71,599,135 A38E probably benign Het
Fam170b A G 14: 32,836,314 K369E unknown Het
Fam187b T A 7: 30,977,154 C29* probably null Het
Fam20c T C 5: 138,766,637 S260P possibly damaging Het
Fam216b G A 14: 78,086,674 A21V possibly damaging Het
Fam98a A T 17: 75,538,487 Y421* probably null Het
Farp2 T C 1: 93,576,500 V333A probably damaging Het
Fcgr1 T C 3: 96,292,312 Y93C probably damaging Het
Fgd2 A T 17: 29,365,552 I157F probably damaging Het
Frmd4b T A 6: 97,325,426 probably benign Het
Fut9 T C 4: 25,620,526 D96G possibly damaging Het
Glt8d1 G A 14: 31,010,410 probably null Het
Gm7579 T A 7: 142,212,384 C176S unknown Het
Gmpr2 A G 14: 55,677,988 E272G probably damaging Het
Grin2b T C 6: 135,733,929 H873R probably damaging Het
Gtf2i C T 5: 134,242,173 probably benign Het
Htr3b A T 9: 48,947,631 V69E probably benign Het
Icam5 A G 9: 21,035,598 N474S probably benign Het
Itgal T A 7: 127,314,060 S610T probably damaging Het
Jag1 T A 2: 137,087,080 I819L probably damaging Het
Kif9 A T 9: 110,511,340 E467V probably benign Het
Krit1 T C 5: 3,823,694 L491P possibly damaging Het
Lipo2 T G 19: 33,746,902 I155L possibly damaging Het
Lsp1 G A 7: 142,488,950 probably benign Het
Marc2 T C 1: 184,841,339 N121D probably benign Het
Mgat5 T A 1: 127,412,248 D455E probably damaging Het
Mical2 A T 7: 112,318,450 Y338F probably damaging Het
Mkl1 G A 15: 81,017,174 T372I probably damaging Het
Mre11a T G 9: 14,815,209 S396A probably benign Het
Myo3a C T 2: 22,544,332 probably benign Het
Naca T C 10: 128,040,355 probably benign Het
Nav1 A T 1: 135,467,643 I996K possibly damaging Het
Ncbp1 A G 4: 46,170,551 N742S probably benign Het
Ndufaf3 G A 9: 108,566,923 A2V probably benign Het
Ntn5 G T 7: 45,686,681 A47S probably damaging Het
Olfr1122 T A 2: 87,387,954 I83N probably damaging Het
Olfr13 T A 6: 43,174,607 V207E possibly damaging Het
Olfr1502 G T 19: 13,862,279 C162F probably benign Het
Olfr384 G A 11: 73,603,392 E271K probably benign Het
Olfr392 T C 11: 73,814,617 H155R probably benign Het
Olfr777 T C 10: 129,269,152 Y57C possibly damaging Het
Otud7a T A 7: 63,727,472 L203* probably null Het
Pcdhb13 A G 18: 37,443,931 Y454C probably damaging Het
Pdzph1 C T 17: 58,954,479 V853M possibly damaging Het
Plec A G 15: 76,172,253 S4517P probably damaging Het
Pm20d2 C T 4: 33,181,746 E286K probably damaging Het
Polr2i T A 7: 30,232,745 probably null Het
Ppp1r12b A G 1: 134,776,479 L879P probably damaging Het
Prf1 C A 10: 61,303,722 Y486* probably null Het
Qsox2 T G 2: 26,214,044 T325P probably damaging Het
Rab1b G T 19: 5,100,656 probably benign Het
Rbm19 T C 5: 120,128,316 probably null Het
Rhobtb2 A G 14: 69,793,948 V576A probably benign Het
Rnps1 G A 17: 24,424,437 V215M probably damaging Het
Rps11 A G 7: 45,124,282 probably benign Het
Serpinb3d C T 1: 107,079,347 M210I probably damaging Het
Sgsm1 T C 5: 113,310,562 T17A probably benign Het
Slc6a3 A G 13: 73,538,642 T43A probably damaging Het
Sox4 C G 13: 28,952,904 A40P probably damaging Het
Spry2 A T 14: 105,893,310 D147E possibly damaging Het
Stpg1 A G 4: 135,519,431 N157D possibly damaging Het
Sumf1 T C 6: 108,173,414 D152G probably benign Het
Tbr1 T C 2: 61,811,620 S410P possibly damaging Het
Tdrd6 A G 17: 43,629,383 V258A probably damaging Het
Tirap C T 9: 35,188,761 G209D probably damaging Het
Tnfrsf8 A T 4: 145,296,861 V134D probably damaging Het
Tnr A G 1: 159,850,335 T97A probably benign Het
Tspan32 T A 7: 143,015,610 F135L probably damaging Het
Ttn T C 2: 76,789,056 K16021E probably damaging Het
Tusc3 T A 8: 39,096,968 I251N probably damaging Het
Usp38 A T 8: 81,005,366 I305N probably damaging Het
Usp4 T A 9: 108,370,881 probably null Het
Usp5 A T 6: 124,817,424 D764E probably damaging Het
Vangl2 A T 1: 172,004,657 V544E probably damaging Het
Vldlr G A 19: 27,234,819 V78M probably damaging Het
Vmn1r29 T C 6: 58,307,772 V159A probably benign Het
Vmn2r16 T A 5: 109,363,896 F656L probably damaging Het
Wdfy3 T A 5: 101,906,185 I1590F possibly damaging Het
Xpo1 T A 11: 23,280,402 V263E probably damaging Het
Zbtb38 A G 9: 96,685,954 S1026P probably damaging Het
Zfp407 A T 18: 84,562,567 D140E possibly damaging Het
Zfp637 T A 6: 117,845,686 Y258* probably null Het
Zfp951 T A 5: 104,814,572 Q376L possibly damaging Het
Other mutations in Lmbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Lmbr1 APN 5 29235055 missense probably damaging 1.00
IGL02285:Lmbr1 APN 5 29254235 splice site probably benign
IGL02793:Lmbr1 APN 5 29292188 missense probably damaging 1.00
IGL02875:Lmbr1 APN 5 29292188 missense probably damaging 1.00
IGL03103:Lmbr1 APN 5 29235016 missense probably damaging 0.99
IGL02988:Lmbr1 UTSW 5 29292223 splice site probably null
R0255:Lmbr1 UTSW 5 29252755 missense probably damaging 1.00
R0993:Lmbr1 UTSW 5 29287393 missense probably damaging 1.00
R1036:Lmbr1 UTSW 5 29258747 missense probably damaging 1.00
R1570:Lmbr1 UTSW 5 29254558 missense probably damaging 1.00
R1724:Lmbr1 UTSW 5 29361083 missense probably benign 0.03
R2056:Lmbr1 UTSW 5 29233094 missense probably benign 0.07
R2996:Lmbr1 UTSW 5 29363933 missense probably benign 0.29
R4082:Lmbr1 UTSW 5 29258755 missense probably damaging 1.00
R4618:Lmbr1 UTSW 5 29346865 missense probably damaging 1.00
R4842:Lmbr1 UTSW 5 29287426 missense probably damaging 0.97
R4857:Lmbr1 UTSW 5 29323809 missense probably damaging 0.98
R5495:Lmbr1 UTSW 5 29346853 nonsense probably null
R5647:Lmbr1 UTSW 5 29263393 critical splice donor site probably null
R6393:Lmbr1 UTSW 5 29254294 missense probably damaging 1.00
R6466:Lmbr1 UTSW 5 29378168 missense probably benign 0.05
R6486:Lmbr1 UTSW 5 29323861 missense probably damaging 0.99
R6576:Lmbr1 UTSW 5 29291310 missense probably damaging 1.00
R6874:Lmbr1 UTSW 5 29292906 missense probably damaging 1.00
R7085:Lmbr1 UTSW 5 29361092 splice site probably null
R7484:Lmbr1 UTSW 5 29346852 start gained probably benign
R7487:Lmbr1 UTSW 5 29254264 missense probably benign 0.38
Z1088:Lmbr1 UTSW 5 29323816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTGCAAAAGGCTTAGTGAACAAAC -3'
(R):5'- TCATGGAGCATTTTCTCCCTTTGAAACA -3'

Sequencing Primer
(F):5'- AAAGGCTTAGTGAACAAACTATCC -3'
(R):5'- CATTTTCTCCCTTTGAAACATTTCTC -3'
Posted On2013-07-11