Mutagenetix > Incidental Mutation

Incidental Mutation 'R7210:Nbeal1'

560974

Institutional Source

Beutler Lab

Gene Symbol

Nbeal1

Ensembl Gene

ENSMUSG00000073664

Gene Name

neurobeachin like 1

Synonyms

A530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik

MMRRC Submission

045239-MU

Accession Numbers

Genbank: NM_173444; MGI: 2444343

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7210 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60180599-60338328 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 60237151 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 684 (V684L)

Ref Sequence

ENSEMBL: ENSMUSP00000124056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160834] [ENSMUST00000160980]

AlphaFold

E9PYP2

Predicted Effect

probably benign
Transcript: ENSMUST00000160834
AA Change: V684L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: V684L

Domain	Start	End	E-Value	Type
low complexity region	522	541	N/A	INTRINSIC
Pfam:Laminin_G_3	567	801	8.3e-9	PFAM
low complexity region	1383	1401	N/A	INTRINSIC
low complexity region	1849	1865	N/A	INTRINSIC
Pfam:PH_BEACH	1882	1975	4.9e-32	PFAM
Beach	1998	2278	7.2e-199	SMART
Blast:Beach	2342	2405	6e-30	BLAST
WD40	2425	2463	5.52e-2	SMART
WD40	2475	2514	4.95e-4	SMART
WD40	2604	2649	7.64e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160980

SMART Domains

Protein: ENSMUSP00000125147
Gene: ENSMUSG00000073664

Domain	Start	End	E-Value	Type
low complexity region	278	297	N/A	INTRINSIC

Meta Mutation Damage Score

0.1198

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (60/60)

Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	G	A	11: 94,373,941	P194S	probably benign	Het
Ackr2	C	T	9: 121,908,877	A106V	possibly damaging	Het
Alg3	G	A	16: 20,605,894	P112L	unknown	Het
Areg	T	A	5: 91,140,905	Y23*	probably null	Het
Aspn	A	G	13: 49,566,491	T328A	probably benign	Het
B020011L13Rik	A	T	1: 117,801,511	E249D	possibly damaging	Het
Bptf	G	A	11: 107,054,464	Q2650*	probably null	Het
Btbd3	A	T	2: 138,283,744	R283W	probably damaging	Het
Cep131	T	C	11: 120,064,789	H1035R	probably damaging	Het
Cfap57	A	T	4: 118,576,703	Y959*	probably null	Het
Cnot1	T	C	8: 95,788,658	Y25C	probably damaging	Het
Crebbp	G	A	16: 4,084,257	H2373Y	possibly damaging	Het
Ctnna3	T	C	10: 64,250,768	L373P	probably damaging	Het
Cyp8b1	T	A	9: 121,915,180	D362V	probably damaging	Het
D430042O09Rik	T	C	7: 125,872,239	V1504A	probably damaging	Het
D630003M21Rik	T	A	2: 158,216,012		probably null	Het
Dpp6	T	C	5: 27,598,803	I249T	probably damaging	Het
Fam149b	T	G	14: 20,378,472	I475M	probably damaging	Het
Fat1	A	G	8: 45,023,503	Y1862C	probably damaging	Het
Fcrl5	A	T	3: 87,446,412	N355Y	possibly damaging	Het
Fgd6	C	T	10: 94,134,092	T1201I	probably damaging	Het
Fndc8	A	T	11: 82,897,866	D174V	probably damaging	Het
Gatb	A	G	3: 85,574,220	H26R	probably benign	Het
Gm37240	T	A	3: 84,497,807	T230S	probably benign	Het
Gria4	T	C	9: 4,464,135	Q609R	probably damaging	Het
Gse1	C	A	8: 120,230,702	T644K	unknown	Het
Ifit1bl1	T	G	19: 34,594,164	I298L	probably benign	Het
Il31ra	T	C	13: 112,549,500	D85G	possibly damaging	Het
Lyst	T	C	13: 13,656,983	L1664P	probably damaging	Het
Mrpl35	A	G	6: 71,817,738	L82S	possibly damaging	Het
Myo7b	G	A	18: 32,007,102	R212C	probably damaging	Het
Myom2	T	C	8: 15,104,114	V684A	probably damaging	Het
Nop58	G	T	1: 59,710,380		probably null	Het
Nudt13	T	A	14: 20,309,784	I193N	possibly damaging	Het
Nyap1	C	A	5: 137,737,982	R81L	probably damaging	Het
Olfr388-ps1	T	C	11: 73,724,873	I50M	possibly damaging	Het
Oxct2b	A	C	4: 123,116,276		probably benign	Het
Pcf11	C	T	7: 92,663,476	A230T	probably benign	Het
Phactr4	A	T	4: 132,358,271	*695R	probably null	Het
Pkd1	T	C	17: 24,575,866	S2176P	probably damaging	Het
Plch2	C	A	4: 155,009,086	R133L	probably damaging	Het
Ptprq	G	T	10: 107,685,171	N713K	probably damaging	Het
Ptrh2	A	T	11: 86,689,967	T137S	probably benign	Het
R3hdm1	A	G	1: 128,211,208	Y718C	possibly damaging	Het
Rftn1	T	A	17: 49,994,307	R505*	probably null	Het
Rps15a	A	G	7: 118,109,111	F128L	probably benign	Het
Slc25a25	A	T	2: 32,420,396	M177K	possibly damaging	Het
Smgc	C	A	15: 91,860,294	P631Q	probably damaging	Het
Sox2	T	C	3: 34,651,157	S248P	probably damaging	Het
Sycp1	T	C	3: 102,853,492	K702E	probably damaging	Het
Tes	G	T	6: 17,104,762	C414F	probably damaging	Het
Tet1	A	T	10: 62,814,501	C14S	probably null	Het
Tle3	C	T	9: 61,412,305	P452S	probably damaging	Het
Tmc6	A	C	11: 117,775,844	L131R	possibly damaging	Het
Tnip3	C	T	6: 65,593,511	R30*	probably null	Het
Tnrc6b	G	T	15: 80,929,285	G1748W	probably damaging	Het
Ugt2b38	T	G	5: 87,410,425	D459A	probably damaging	Het
Zdhhc2	A	T	8: 40,467,439	R246S	probably damaging	Het
Zscan22	T	A	7: 12,906,821	C331S	probably damaging	Het

Other mutations in Nbeal1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Nbeal1	APN	1	60235191	nonsense	probably null	0.00
IGL00334:Nbeal1	APN	1	60281883	missense	probably damaging	0.98
IGL00334:Nbeal1	APN	1	60328103	missense	probably damaging	1.00
IGL00514:Nbeal1	APN	1	60217225	missense	probably benign	0.31
IGL00596:Nbeal1	APN	1	60181741	missense	probably damaging	0.96
IGL00654:Nbeal1	APN	1	60195011	critical splice acceptor site	probably benign	0.00
IGL00757:Nbeal1	APN	1	60195143	missense	possibly damaging	0.82
IGL00771:Nbeal1	APN	1	60235353	missense	probably benign	0.11
IGL01315:Nbeal1	APN	1	60281341	missense	probably damaging	1.00
IGL01445:Nbeal1	APN	1	60242625	critical splice donor site	probably null
IGL01456:Nbeal1	APN	1	60230628	missense	probably damaging	1.00
IGL01458:Nbeal1	APN	1	60242625	critical splice donor site	probably null
IGL01535:Nbeal1	APN	1	60217255	missense	probably damaging	1.00
IGL01608:Nbeal1	APN	1	60242535	critical splice acceptor site	probably benign	0.00
IGL02006:Nbeal1	APN	1	60272259	critical splice donor site	probably null
IGL02105:Nbeal1	APN	1	60253501	missense	probably damaging	1.00
IGL02409:Nbeal1	APN	1	60329335	missense	probably benign	0.01
IGL02713:Nbeal1	APN	1	60235237	missense	possibly damaging	0.94
IGL02720:Nbeal1	APN	1	60283987	missense	probably damaging	0.98
IGL02887:Nbeal1	APN	1	60287444	splice site	probably benign
IGL02945:Nbeal1	APN	1	60206410	missense	probably damaging	1.00
IGL03023:Nbeal1	APN	1	60253413	missense	probably damaging	0.98
IGL03114:Nbeal1	APN	1	60278727	missense	probably damaging	1.00
IGL03231:Nbeal1	APN	1	60236459	missense	probably benign	0.44
IGL03241:Nbeal1	APN	1	60234868	missense	possibly damaging	0.46
IGL03241:Nbeal1	APN	1	60234869	missense	probably benign	0.44
IGL03382:Nbeal1	APN	1	60261586	critical splice donor site	probably null
IGL03412:Nbeal1	APN	1	60242567	nonsense	probably null
coach	UTSW	1	60253481	nonsense	probably null
Committee	UTSW	1	60292903	missense	probably damaging	1.00
Disgrace	UTSW	1	60281310	nonsense	probably null
Dravrah	UTSW	1	60284092	missense	probably damaging	1.00
Harvard	UTSW	1	60235563	splice site	probably null
horrified	UTSW	1	60244824	missense	probably damaging	1.00
Lampoon	UTSW	1	60261586	critical splice donor site	probably null
lawyer	UTSW	1	60310224	nonsense	probably null
magistrate	UTSW	1	60194597	critical splice donor site	probably null
Maratimus	UTSW	1	60291888	missense	probably damaging	1.00
National	UTSW	1	60222263	missense	possibly damaging	0.95
phainopepla	UTSW	1	60319687	missense	probably damaging	1.00
R3875_Nbeal1_770	UTSW	1	60194599	splice site	probably benign
satirical	UTSW	1	60235562	critical splice donor site	probably null
silky	UTSW	1	60330878	splice site	probably benign
stiggs	UTSW	1	60237151	missense	probably benign	0.11
3-1:Nbeal1	UTSW	1	60264272	splice site	probably benign
P0007:Nbeal1	UTSW	1	60319688	missense	probably damaging	0.98
P0028:Nbeal1	UTSW	1	60291937	missense	probably damaging	1.00
R0041:Nbeal1	UTSW	1	60281871	missense	probably benign	0.05
R0051:Nbeal1	UTSW	1	60310263	missense	probably benign	0.19
R0052:Nbeal1	UTSW	1	60228612	splice site	probably benign
R0054:Nbeal1	UTSW	1	60287401	utr 3 prime	probably benign
R0062:Nbeal1	UTSW	1	60247717	missense	probably benign	0.01
R0062:Nbeal1	UTSW	1	60247717	missense	probably benign	0.01
R0094:Nbeal1	UTSW	1	60305309	missense	possibly damaging	0.62
R0310:Nbeal1	UTSW	1	60305370	splice site	probably benign
R0324:Nbeal1	UTSW	1	60292873	missense	probably damaging	1.00
R0329:Nbeal1	UTSW	1	60268063	missense	probably damaging	1.00
R0330:Nbeal1	UTSW	1	60268063	missense	probably damaging	1.00
R0417:Nbeal1	UTSW	1	60247734	missense	probably benign	0.00
R0421:Nbeal1	UTSW	1	60268439	missense	probably benign	0.08
R0617:Nbeal1	UTSW	1	60281832	nonsense	probably null
R1034:Nbeal1	UTSW	1	60290006	nonsense	probably null
R1082:Nbeal1	UTSW	1	60312226	missense	probably damaging	0.99
R1123:Nbeal1	UTSW	1	60260269	missense	probably benign
R1187:Nbeal1	UTSW	1	60194528	missense	probably damaging	1.00
R1484:Nbeal1	UTSW	1	60200939	missense	probably damaging	1.00
R1594:Nbeal1	UTSW	1	60305291	missense	possibly damaging	0.91
R1651:Nbeal1	UTSW	1	60200119	missense	probably damaging	1.00
R1678:Nbeal1	UTSW	1	60260334	missense	probably benign	0.00
R1806:Nbeal1	UTSW	1	60284092	missense	probably damaging	1.00
R1937:Nbeal1	UTSW	1	60267941	nonsense	probably null
R1952:Nbeal1	UTSW	1	60234840	missense	probably damaging	1.00
R1953:Nbeal1	UTSW	1	60234840	missense	probably damaging	1.00
R2038:Nbeal1	UTSW	1	60206344	missense	probably benign	0.00
R2044:Nbeal1	UTSW	1	60319687	missense	probably damaging	1.00
R2050:Nbeal1	UTSW	1	60292964	splice site	probably null
R2055:Nbeal1	UTSW	1	60311057	missense	probably damaging	1.00
R2064:Nbeal1	UTSW	1	60270356	missense	possibly damaging	0.89
R2100:Nbeal1	UTSW	1	60305271	splice site	probably null
R2181:Nbeal1	UTSW	1	60278780	missense	probably damaging	1.00
R2192:Nbeal1	UTSW	1	60281895	missense	probably damaging	1.00
R2203:Nbeal1	UTSW	1	60284006	missense	probably benign	0.21
R2267:Nbeal1	UTSW	1	60330878	splice site	probably benign
R2268:Nbeal1	UTSW	1	60330878	splice site	probably benign
R2351:Nbeal1	UTSW	1	60237098	missense	possibly damaging	0.90
R2366:Nbeal1	UTSW	1	60251352	missense	probably damaging	0.97
R2393:Nbeal1	UTSW	1	60251370	missense	probably damaging	0.98
R3545:Nbeal1	UTSW	1	60278780	missense	probably damaging	1.00
R3546:Nbeal1	UTSW	1	60278780	missense	probably damaging	1.00
R3547:Nbeal1	UTSW	1	60278780	missense	probably damaging	1.00
R3701:Nbeal1	UTSW	1	60251413	splice site	probably benign
R3747:Nbeal1	UTSW	1	60195023	missense	probably damaging	0.98
R3875:Nbeal1	UTSW	1	60194599	splice site	probably benign
R4119:Nbeal1	UTSW	1	60291870	missense	probably damaging	0.99
R4256:Nbeal1	UTSW	1	60330948	missense	probably benign	0.19
R4371:Nbeal1	UTSW	1	60289946	missense	possibly damaging	0.95
R4450:Nbeal1	UTSW	1	60267774	missense	probably damaging	0.97
R4558:Nbeal1	UTSW	1	60281310	nonsense	probably null
R4618:Nbeal1	UTSW	1	60228731	intron	probably benign
R4673:Nbeal1	UTSW	1	60329390	missense	probably damaging	1.00
R4719:Nbeal1	UTSW	1	60235563	splice site	probably null
R4798:Nbeal1	UTSW	1	60222193	splice site	probably null
R4826:Nbeal1	UTSW	1	60251342	missense	possibly damaging	0.79
R4841:Nbeal1	UTSW	1	60253375	missense	probably damaging	1.00
R4842:Nbeal1	UTSW	1	60253375	missense	probably damaging	1.00
R4895:Nbeal1	UTSW	1	60292903	missense	probably damaging	1.00
R4929:Nbeal1	UTSW	1	60238654	missense	probably damaging	1.00
R5026:Nbeal1	UTSW	1	60237179	missense	probably damaging	1.00
R5243:Nbeal1	UTSW	1	60270328	missense	probably damaging	0.99
R5300:Nbeal1	UTSW	1	60235559	nonsense	probably null
R5345:Nbeal1	UTSW	1	60328210	critical splice donor site	probably null
R5502:Nbeal1	UTSW	1	60310999	missense	probably damaging	1.00
R5542:Nbeal1	UTSW	1	60277194	missense	probably benign	0.00
R5555:Nbeal1	UTSW	1	60237152	missense	possibly damaging	0.93
R5580:Nbeal1	UTSW	1	60242602	missense	probably benign	0.45
R5765:Nbeal1	UTSW	1	60291847	missense	probably damaging	1.00
R5802:Nbeal1	UTSW	1	60272221	missense	probably benign	0.01
R5907:Nbeal1	UTSW	1	60228791	intron	probably benign
R5918:Nbeal1	UTSW	1	60267892	missense	possibly damaging	0.90
R5923:Nbeal1	UTSW	1	60248395	missense	probably damaging	1.00
R6066:Nbeal1	UTSW	1	60248405	missense	probably benign	0.29
R6091:Nbeal1	UTSW	1	60181556	start gained	probably benign
R6113:Nbeal1	UTSW	1	60222263	missense	possibly damaging	0.95
R6143:Nbeal1	UTSW	1	60251307	missense	possibly damaging	0.81
R6194:Nbeal1	UTSW	1	60257484	missense	possibly damaging	0.80
R6197:Nbeal1	UTSW	1	60222128	missense	probably damaging	0.99
R6228:Nbeal1	UTSW	1	60295924	missense	probably benign	0.00
R6229:Nbeal1	UTSW	1	60248365	missense	possibly damaging	0.88
R6309:Nbeal1	UTSW	1	60238719	missense	probably benign
R6457:Nbeal1	UTSW	1	60253474	missense	probably benign	0.31
R6489:Nbeal1	UTSW	1	60330942	missense	possibly damaging	0.89
R6845:Nbeal1	UTSW	1	60281310	nonsense	probably null
R7021:Nbeal1	UTSW	1	60261586	critical splice donor site	probably null
R7033:Nbeal1	UTSW	1	60310947	missense	probably damaging	1.00
R7144:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7145:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7146:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7157:Nbeal1	UTSW	1	60237158	missense	probably damaging	1.00
R7157:Nbeal1	UTSW	1	60260634	nonsense	probably null
R7209:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7211:Nbeal1	UTSW	1	60200951	missense	probably damaging	1.00
R7212:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7213:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7214:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7283:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7285:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7287:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7296:Nbeal1	UTSW	1	60310224	nonsense	probably null
R7312:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7313:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7329:Nbeal1	UTSW	1	60217196	missense	probably benign	0.39
R7380:Nbeal1	UTSW	1	60244810	missense	probably damaging	1.00
R7414:Nbeal1	UTSW	1	60194597	critical splice donor site	probably null
R7477:Nbeal1	UTSW	1	60261584	missense	probably benign
R7507:Nbeal1	UTSW	1	60235467	missense	probably damaging	1.00
R7642:Nbeal1	UTSW	1	60277227	missense	probably benign	0.31
R7678:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7689:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7728:Nbeal1	UTSW	1	60244824	missense	probably damaging	1.00
R7757:Nbeal1	UTSW	1	60257450	missense	probably damaging	0.97
R7761:Nbeal1	UTSW	1	60319341	missense	probably benign	0.00
R7813:Nbeal1	UTSW	1	60291889	missense	probably damaging	1.00
R7829:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7891:Nbeal1	UTSW	1	60260432	missense	probably benign
R7902:Nbeal1	UTSW	1	60291870	missense	probably damaging	0.99
R8022:Nbeal1	UTSW	1	60260272	nonsense	probably null
R8053:Nbeal1	UTSW	1	60279795	missense	probably damaging	0.98
R8169:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8170:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8178:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8182:Nbeal1	UTSW	1	60200133	missense	probably benign	0.00
R8186:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8187:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8193:Nbeal1	UTSW	1	60253481	nonsense	probably null
R8209:Nbeal1	UTSW	1	60277177	missense	probably damaging	0.99
R8226:Nbeal1	UTSW	1	60277177	missense	probably damaging	0.99
R8549:Nbeal1	UTSW	1	60235562	critical splice donor site	probably null
R8560:Nbeal1	UTSW	1	60235157	missense	probably benign	0.38
R8753:Nbeal1	UTSW	1	60268383	missense	probably damaging	1.00
R8769:Nbeal1	UTSW	1	60235211	missense	probably damaging	0.99
R8771:Nbeal1	UTSW	1	60261584	missense	probably benign
R8952:Nbeal1	UTSW	1	60260300	missense	probably benign	0.01
R9014:Nbeal1	UTSW	1	60289959	missense	probably damaging	1.00
R9056:Nbeal1	UTSW	1	60278726	missense	probably damaging	1.00
R9091:Nbeal1	UTSW	1	60268389	missense	possibly damaging	0.50
R9138:Nbeal1	UTSW	1	60247745	nonsense	probably null
R9168:Nbeal1	UTSW	1	60291888	missense	probably damaging	1.00
R9200:Nbeal1	UTSW	1	60281266	missense	probably damaging	1.00
R9205:Nbeal1	UTSW	1	60278680	missense	probably damaging	1.00
R9270:Nbeal1	UTSW	1	60268389	missense	possibly damaging	0.50
R9322:Nbeal1	UTSW	1	60258659	missense	possibly damaging	0.91
R9405:Nbeal1	UTSW	1	60310265	missense	probably damaging	1.00
R9554:Nbeal1	UTSW	1	60251128	nonsense	probably null
R9557:Nbeal1	UTSW	1	60235350	missense	probably benign
R9560:Nbeal1	UTSW	1	60329385	missense	probably damaging	1.00
R9641:Nbeal1	UTSW	1	60311088	missense	probably damaging	1.00
R9784:Nbeal1	UTSW	1	60260582	nonsense	probably null
X0022:Nbeal1	UTSW	1	60277232	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCTTTGAAGATTTCCTAGGCTGG -3'
(R):5'- GTCTTTGGCTTTGCTGAACC -3'

Sequencing Primer
(F):5'- TGTTAAACCAGTTATCTCTGTTGC -3'
(R):5'- TGCTGAACCTACTTCTCCAAAC -3'

Posted On

2019-06-26