Incidental Mutation 'R7210:R3hdm1'
ID560976
Institutional Source Beutler Lab
Gene Symbol R3hdm1
Ensembl Gene ENSMUSG00000056211
Gene NameR3H domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7210 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location128103301-128237736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128211208 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 718 (Y718C)
Ref Sequence ENSEMBL: ENSMUSP00000043103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036288] [ENSMUST00000190056]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036288
AA Change: Y718C

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043103
Gene: ENSMUSG00000056211
AA Change: Y718C

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 8.8e-15 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 624 642 N/A INTRINSIC
low complexity region 909 927 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190056
AA Change: Y375C

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140209
Gene: ENSMUSG00000056211
AA Change: Y375C

DomainStartEndE-ValueType
low complexity region 82 115 N/A INTRINSIC
low complexity region 202 225 N/A INTRINSIC
low complexity region 281 299 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Areg T A 5: 91,140,905 Y23* probably null Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in R3hdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:R3hdm1 APN 1 128236439 missense probably damaging 1.00
IGL00799:R3hdm1 APN 1 128174963 missense probably damaging 1.00
IGL00835:R3hdm1 APN 1 128235632 splice site probably benign
IGL00885:R3hdm1 APN 1 128236438 missense probably damaging 0.99
IGL00990:R3hdm1 APN 1 128162196 intron probably benign
IGL01137:R3hdm1 APN 1 128181875 missense probably damaging 1.00
IGL01323:R3hdm1 APN 1 128216543 missense probably benign
IGL01461:R3hdm1 APN 1 128178906 missense probably damaging 1.00
IGL01565:R3hdm1 APN 1 128186816 missense probably damaging 1.00
IGL01813:R3hdm1 APN 1 128175233 critical splice donor site probably null
IGL01837:R3hdm1 APN 1 128186760 nonsense probably null
IGL01934:R3hdm1 APN 1 128236535 missense probably benign 0.12
IGL02074:R3hdm1 APN 1 128169038 missense possibly damaging 0.48
IGL02532:R3hdm1 APN 1 128197099 critical splice donor site probably null
IGL02606:R3hdm1 APN 1 128190719 missense probably benign 0.00
IGL02851:R3hdm1 APN 1 128174940 splice site probably benign
driven UTSW 1 128193565 missense probably benign 0.00
R0023:R3hdm1 UTSW 1 128211192 splice site probably benign
R0280:R3hdm1 UTSW 1 128162775 missense probably benign 0.00
R0482:R3hdm1 UTSW 1 128184517 missense probably benign 0.12
R0521:R3hdm1 UTSW 1 128193703 missense probably benign 0.07
R0578:R3hdm1 UTSW 1 128231437 nonsense probably null
R0698:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0701:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0961:R3hdm1 UTSW 1 128193596 missense probably benign 0.13
R1026:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1141:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1319:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1320:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1511:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1705:R3hdm1 UTSW 1 128235084 missense probably damaging 1.00
R1991:R3hdm1 UTSW 1 128169016 missense probably damaging 0.99
R2140:R3hdm1 UTSW 1 128190693 missense probably damaging 0.99
R2437:R3hdm1 UTSW 1 128186836 missense probably damaging 0.98
R2447:R3hdm1 UTSW 1 128186929 intron probably benign
R4564:R3hdm1 UTSW 1 128221659 missense probably benign 0.16
R4640:R3hdm1 UTSW 1 128175238 splice site probably benign
R4649:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4650:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4652:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4653:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4696:R3hdm1 UTSW 1 128236766 utr 3 prime probably benign
R5393:R3hdm1 UTSW 1 128231347 missense probably benign
R5554:R3hdm1 UTSW 1 128236672 missense probably benign 0.27
R5979:R3hdm1 UTSW 1 128211223 missense probably benign 0.04
R6123:R3hdm1 UTSW 1 128169036 missense probably damaging 0.99
R6185:R3hdm1 UTSW 1 128151861 missense possibly damaging 0.93
R6618:R3hdm1 UTSW 1 128193565 missense probably benign 0.00
R6636:R3hdm1 UTSW 1 128162811 frame shift probably null
R6639:R3hdm1 UTSW 1 128162811 frame shift probably null
R6756:R3hdm1 UTSW 1 128162811 frame shift probably null
R7168:R3hdm1 UTSW 1 128216495 missense probably benign 0.05
R7367:R3hdm1 UTSW 1 128153392 missense possibly damaging 0.64
R7536:R3hdm1 UTSW 1 128182211 splice site probably null
X0017:R3hdm1 UTSW 1 128167921 missense possibly damaging 0.92
X0020:R3hdm1 UTSW 1 128169033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCCAGTGAATTTCCTCACC -3'
(R):5'- CTATCCCTAAAGCAGGTGAGAG -3'

Sequencing Primer
(F):5'- GTGAATTTCCTCACCCATAGAAGTC -3'
(R):5'- GAAAACATACCTGATATGATGGCAC -3'
Posted On2019-06-26