Incidental Mutation 'R7210:Slc25a25'
ID560977
Institutional Source Beutler Lab
Gene Symbol Slc25a25
Ensembl Gene ENSMUSG00000026819
Gene Namesolute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25
Synonyms1110030N17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7210 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32414487-32451445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32420396 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 177 (M177K)
Ref Sequence ENSEMBL: ENSMUSP00000028160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028160] [ENSMUST00000052119] [ENSMUST00000113307] [ENSMUST00000113308] [ENSMUST00000113310] [ENSMUST00000136361] [ENSMUST00000153886]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028160
AA Change: M177K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028160
Gene: ENSMUSG00000026819
AA Change: M177K

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
EFh 48 76 8.73e0 SMART
EFh 84 112 2.64e-1 SMART
EFh 115 143 1.36e0 SMART
Blast:EFh 151 191 1e-9 BLAST
Pfam:Mito_carr 227 320 1.7e-26 PFAM
Pfam:Mito_carr 321 413 6.4e-26 PFAM
Pfam:Mito_carr 418 512 9.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052119
AA Change: M164K

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000060581
Gene: ENSMUSG00000026819
AA Change: M164K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EFh 71 99 4.53e0 SMART
EFh 102 130 1.36e0 SMART
Blast:EFh 138 178 2e-9 BLAST
Pfam:Mito_carr 214 307 1.2e-26 PFAM
Pfam:Mito_carr 308 400 2.5e-27 PFAM
Pfam:Mito_carr 405 500 4.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113307
AA Change: M132K

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108932
Gene: ENSMUSG00000026819
AA Change: M132K

DomainStartEndE-ValueType
EFh 51 79 9.51e0 SMART
EFh 82 110 1.36e0 SMART
EFh 118 146 8.82e1 SMART
Pfam:Mito_carr 182 275 1.1e-26 PFAM
Pfam:Mito_carr 276 368 2.2e-27 PFAM
Pfam:Mito_carr 373 468 4.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113308
AA Change: M152K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108933
Gene: ENSMUSG00000026819
AA Change: M152K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EFh 71 99 4.53e0 SMART
EFh 102 130 1.36e0 SMART
EFh 138 166 8.82e1 SMART
Pfam:Mito_carr 202 295 1.1e-26 PFAM
Pfam:Mito_carr 296 388 2.4e-27 PFAM
Pfam:Mito_carr 393 488 4.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113310
AA Change: M165K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108936
Gene: ENSMUSG00000026819
AA Change: M165K

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
EFh 48 76 8.73e0 SMART
EFh 84 112 2.64e-1 SMART
EFh 115 143 1.36e0 SMART
EFh 151 179 8.82e1 SMART
Pfam:Mito_carr 215 308 1.2e-26 PFAM
Pfam:Mito_carr 309 401 2.5e-27 PFAM
Pfam:Mito_carr 406 501 4.9e-21 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121932
Gene: ENSMUSG00000026819
AA Change: M128K

DomainStartEndE-ValueType
EFh 36 64 8.99e0 SMART
EFh 67 95 1.36e0 SMART
Blast:EFh 103 143 1e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000136361
AA Change: M117K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115617
Gene: ENSMUSG00000026819
AA Change: M117K

DomainStartEndE-ValueType
EFh 36 64 8.99e0 SMART
EFh 67 95 1.36e0 SMART
EFh 103 131 8.82e1 SMART
Pfam:Mito_carr 167 260 9.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153886
AA Change: M29K

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141486
Gene: ENSMUSG00000026819
AA Change: M29K

DomainStartEndE-ValueType
SCOP:d1exra_ 1 38 1e-4 SMART
Blast:EFh 15 43 2e-13 BLAST
Pfam:Mito_carr 79 112 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of calcium-binding mitochondrial carriers, with a characteristic mitochondrial carrier domain at the C-terminus. These proteins are found in the inner membranes of mitochondria, and function as transport proteins. They shuttle metabolites, nucleotides and cofactors through the mitochondrial membrane and thereby connect and/or regulate cytoplasm and matrix functions. This protein may function as an ATP-Mg/Pi carrier that mediates the transport of Mg-ATP in exchange for phosphate, and likely responsible for the net uptake or efflux of adenine nucleotides into or from the mitochondria. Alternatively spliced transcript variants encoding different isoforms with a common C-terminus but variable N-termini have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced physical endurance and metabolic efficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Areg T A 5: 91,140,905 Y23* probably null Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Slc25a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Slc25a25 APN 2 32419160 missense probably benign 0.04
IGL01431:Slc25a25 APN 2 32419091 missense probably damaging 1.00
IGL02211:Slc25a25 APN 2 32417440 missense probably damaging 1.00
IGL02393:Slc25a25 APN 2 32417843 missense probably benign 0.40
R0385:Slc25a25 UTSW 2 32417822 missense probably damaging 0.99
R1208:Slc25a25 UTSW 2 32417425 missense probably benign 0.11
R1208:Slc25a25 UTSW 2 32417425 missense probably benign 0.11
R1611:Slc25a25 UTSW 2 32420379 missense probably damaging 1.00
R1960:Slc25a25 UTSW 2 32420651 splice site probably null
R2405:Slc25a25 UTSW 2 32417719 splice site probably null
R3749:Slc25a25 UTSW 2 32420380 missense probably benign 0.21
R4446:Slc25a25 UTSW 2 32430609 missense probably benign 0.00
R4815:Slc25a25 UTSW 2 32420410 missense probably damaging 1.00
R5245:Slc25a25 UTSW 2 32421328 nonsense probably null
R6884:Slc25a25 UTSW 2 32420662 missense probably benign 0.34
R7144:Slc25a25 UTSW 2 32419166 missense probably damaging 1.00
R7255:Slc25a25 UTSW 2 32421372 missense possibly damaging 0.60
R7667:Slc25a25 UTSW 2 32451209 missense probably benign 0.00
X0021:Slc25a25 UTSW 2 32421514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGGGACAACATCTCAGTGTATC -3'
(R):5'- AAATGGGGTATGGAGCCACC -3'

Sequencing Primer
(F):5'- TCTCAGTGTATCATCAAGACCG -3'
(R):5'- GGTATGGAGCCACCTTACTC -3'
Posted On2019-06-26