Incidental Mutation 'R7210:Btbd3'
ID560978
Institutional Source Beutler Lab
Gene Symbol Btbd3
Ensembl Gene ENSMUSG00000062098
Gene NameBTB (POZ) domain containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R7210 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location138256565-138589292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138283744 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 283 (R283W)
Ref Sequence ENSEMBL: ENSMUSP00000074864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075410] [ENSMUST00000091556]
Predicted Effect probably damaging
Transcript: ENSMUST00000075410
AA Change: R283W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074864
Gene: ENSMUSG00000062098
AA Change: R283W

DomainStartEndE-ValueType
low complexity region 26 51 N/A INTRINSIC
low complexity region 63 69 N/A INTRINSIC
low complexity region 89 101 N/A INTRINSIC
BTB 128 228 5.55e-23 SMART
BACK 234 343 1.11e-12 SMART
Pfam:PHR 384 529 4.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091556
AA Change: R214W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089144
Gene: ENSMUSG00000062098
AA Change: R214W

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
BTB 59 159 5.55e-23 SMART
BACK 165 274 1.11e-12 SMART
Pfam:PHR 315 461 8.6e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Areg T A 5: 91,140,905 Y23* probably null Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Btbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Btbd3 APN 2 138279777 missense probably benign 0.05
IGL01650:Btbd3 APN 2 138284105 missense probably damaging 1.00
IGL01783:Btbd3 APN 2 138283736 missense probably damaging 1.00
IGL03108:Btbd3 APN 2 138284123 missense possibly damaging 0.55
IGL03232:Btbd3 APN 2 138284143 missense probably damaging 1.00
IGL03259:Btbd3 APN 2 138279760 missense probably damaging 1.00
IGL03405:Btbd3 APN 2 138279761 missense probably damaging 0.98
R0540:Btbd3 UTSW 2 138283816 missense possibly damaging 0.90
R0607:Btbd3 UTSW 2 138283816 missense possibly damaging 0.90
R1171:Btbd3 UTSW 2 138283961 missense probably benign 0.03
R1983:Btbd3 UTSW 2 138283688 missense probably damaging 0.99
R2034:Btbd3 UTSW 2 138278983 missense probably benign 0.15
R5111:Btbd3 UTSW 2 138278909 start codon destroyed probably null 0.53
R6170:Btbd3 UTSW 2 138278942 missense probably damaging 1.00
R6663:Btbd3 UTSW 2 138279083 missense probably benign 0.00
R6708:Btbd3 UTSW 2 138283571 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATAGTTCCTCACCTCGCCAG -3'
(R):5'- AGACTGTGCAGCACCATTTG -3'

Sequencing Primer
(F):5'- AGCCTGTGTTAATTTCCTGGAGACC -3'
(R):5'- TTTGCAAAGTCATCCAGGGC -3'
Posted On2019-06-26