Incidental Mutation 'R7210:Fcrl5'
ID560983
Institutional Source Beutler Lab
Gene Symbol Fcrl5
Ensembl Gene ENSMUSG00000048031
Gene NameFc receptor-like 5
SynonymsBXMAS1-like protein 2, Fcrh3, mBXMH2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7210 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location87435773-87500678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87446412 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 355 (N355Y)
Ref Sequence ENSEMBL: ENSMUSP00000142210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049926] [ENSMUST00000166297] [ENSMUST00000178261] [ENSMUST00000193229] [ENSMUST00000194102]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049926
AA Change: N355Y

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050151
Gene: ENSMUSG00000048031
AA Change: N355Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166297
AA Change: N267Y

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131176
Gene: ENSMUSG00000048031
AA Change: N267Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGc2 40 100 6.16e-4 SMART
IG_like 125 208 4.41e1 SMART
IGc2 228 292 3.97e-7 SMART
IG_like 322 385 2.94e-1 SMART
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178261
AA Change: N355Y

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136046
Gene: ENSMUSG00000048031
AA Change: N355Y

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193229
AA Change: N267Y

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141311
Gene: ENSMUSG00000048031
AA Change: N267Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGc2 40 100 6.16e-4 SMART
IG_like 125 208 4.41e1 SMART
IGc2 228 292 3.97e-7 SMART
IG_like 322 385 2.94e-1 SMART
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194102
AA Change: N355Y

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142210
Gene: ENSMUSG00000048031
AA Change: N355Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin receptor superfamily and the Fc-receptor like family. This gene and several other Fc receptor-like gene members are clustered on the long arm of chromosome 1. The encoded protein is a single-pass type I membrane protein and contains 8 immunoglobulin-like C2-type domains. This gene is implicated in B cell development and lymphomagenesis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Areg T A 5: 91,140,905 Y23* probably null Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Fcrl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Fcrl5 APN 3 87444291 missense probably damaging 0.96
IGL01868:Fcrl5 APN 3 87443707 missense possibly damaging 0.58
IGL01939:Fcrl5 APN 3 87446299 missense probably damaging 0.99
IGL02817:Fcrl5 APN 3 87435913 missense probably benign 0.35
IGL03106:Fcrl5 APN 3 87435883 unclassified probably null
R0381:Fcrl5 UTSW 3 87446460 missense probably damaging 1.00
R0523:Fcrl5 UTSW 3 87457792 missense possibly damaging 0.72
R0646:Fcrl5 UTSW 3 87442013 missense probably benign 0.00
R1231:Fcrl5 UTSW 3 87442179 missense probably benign 0.13
R1353:Fcrl5 UTSW 3 87448362 missense probably damaging 1.00
R1711:Fcrl5 UTSW 3 87457414 missense possibly damaging 0.61
R1714:Fcrl5 UTSW 3 87446406 missense probably damaging 1.00
R1719:Fcrl5 UTSW 3 87457397 missense probably damaging 0.98
R2084:Fcrl5 UTSW 3 87444230 missense probably benign 0.24
R2358:Fcrl5 UTSW 3 87446419 missense probably damaging 0.99
R2884:Fcrl5 UTSW 3 87457391 missense probably damaging 1.00
R2885:Fcrl5 UTSW 3 87457391 missense probably damaging 1.00
R3085:Fcrl5 UTSW 3 87446464 missense probably damaging 1.00
R3153:Fcrl5 UTSW 3 87443680 missense probably benign 0.09
R4288:Fcrl5 UTSW 3 87442224 missense probably benign 0.09
R4289:Fcrl5 UTSW 3 87442224 missense probably benign 0.09
R4614:Fcrl5 UTSW 3 87448426 missense probably damaging 1.00
R4719:Fcrl5 UTSW 3 87444189 missense probably damaging 1.00
R4788:Fcrl5 UTSW 3 87457188 missense probably damaging 1.00
R4920:Fcrl5 UTSW 3 87444173 missense probably damaging 1.00
R4972:Fcrl5 UTSW 3 87454650 missense probably benign 0.00
R5373:Fcrl5 UTSW 3 87446391 missense probably benign 0.01
R5374:Fcrl5 UTSW 3 87446391 missense probably benign 0.01
R5963:Fcrl5 UTSW 3 87444173 missense probably damaging 1.00
R5975:Fcrl5 UTSW 3 87442103 missense probably benign 0.00
R6022:Fcrl5 UTSW 3 87455763 missense probably benign 0.42
R6267:Fcrl5 UTSW 3 87448324 missense probably damaging 1.00
R6372:Fcrl5 UTSW 3 87444194 nonsense probably null
R6393:Fcrl5 UTSW 3 87448327 missense probably damaging 1.00
R7088:Fcrl5 UTSW 3 87457834 makesense probably null
R7175:Fcrl5 UTSW 3 87446338 missense probably benign 0.37
R7217:Fcrl5 UTSW 3 87443774 missense probably damaging 1.00
R7243:Fcrl5 UTSW 3 87442245 missense probably benign
R7776:Fcrl5 UTSW 3 87444195 missense possibly damaging 0.84
R7813:Fcrl5 UTSW 3 87443623 missense probably benign 0.09
X0054:Fcrl5 UTSW 3 87446299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAGCTTCTGCGAGATTCC -3'
(R):5'- TCCCAGGGAAATACATGTTTGAG -3'

Sequencing Primer
(F):5'- GAGCTTCTGCGAGATTCCAAACAC -3'
(R):5'- AATGATGGCTGACTAGGCCATCTTC -3'
Posted On2019-06-26