Mutagenetix > Incidental Mutation

Incidental Mutation 'R7210:Cfap57'

560985

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7210 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 118576703 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 959 (Y959*)

Ref Sequence

ENSEMBL: ENSMUSP00000071863 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

AlphaFold

Q9D180

Predicted Effect

probably null
Transcript: ENSMUST00000071972
AA Change: Y959*

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: Y959*

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000081921
AA Change: Y959*

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: Y959*

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	G	A	11: 94,373,941	P194S	probably benign	Het
Ackr2	C	T	9: 121,908,877	A106V	possibly damaging	Het
Alg3	G	A	16: 20,605,894	P112L	unknown	Het
Areg	T	A	5: 91,140,905	Y23*	probably null	Het
Aspn	A	G	13: 49,566,491	T328A	probably benign	Het
B020011L13Rik	A	T	1: 117,801,511	E249D	possibly damaging	Het
Bptf	G	A	11: 107,054,464	Q2650*	probably null	Het
Btbd3	A	T	2: 138,283,744	R283W	probably damaging	Het
Cep131	T	C	11: 120,064,789	H1035R	probably damaging	Het
Cnot1	T	C	8: 95,788,658	Y25C	probably damaging	Het
Crebbp	G	A	16: 4,084,257	H2373Y	possibly damaging	Het
Ctnna3	T	C	10: 64,250,768	L373P	probably damaging	Het
Cyp8b1	T	A	9: 121,915,180	D362V	probably damaging	Het
D430042O09Rik	T	C	7: 125,872,239	V1504A	probably damaging	Het
D630003M21Rik	T	A	2: 158,216,012		probably null	Het
Dpp6	T	C	5: 27,598,803	I249T	probably damaging	Het
Fam149b	T	G	14: 20,378,472	I475M	probably damaging	Het
Fat1	A	G	8: 45,023,503	Y1862C	probably damaging	Het
Fcrl5	A	T	3: 87,446,412	N355Y	possibly damaging	Het
Fgd6	C	T	10: 94,134,092	T1201I	probably damaging	Het
Fndc8	A	T	11: 82,897,866	D174V	probably damaging	Het
Gatb	A	G	3: 85,574,220	H26R	probably benign	Het
Gm37240	T	A	3: 84,497,807	T230S	probably benign	Het
Gria4	T	C	9: 4,464,135	Q609R	probably damaging	Het
Gse1	C	A	8: 120,230,702	T644K	unknown	Het
Ifit1bl1	T	G	19: 34,594,164	I298L	probably benign	Het
Il31ra	T	C	13: 112,549,500	D85G	possibly damaging	Het
Lyst	T	C	13: 13,656,983	L1664P	probably damaging	Het
Mrpl35	A	G	6: 71,817,738	L82S	possibly damaging	Het
Myo7b	G	A	18: 32,007,102	R212C	probably damaging	Het
Myom2	T	C	8: 15,104,114	V684A	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nop58	G	T	1: 59,710,380		probably null	Het
Nudt13	T	A	14: 20,309,784	I193N	possibly damaging	Het
Nyap1	C	A	5: 137,737,982	R81L	probably damaging	Het
Olfr388-ps1	T	C	11: 73,724,873	I50M	possibly damaging	Het
Oxct2b	A	C	4: 123,116,276		probably benign	Het
Pcf11	C	T	7: 92,663,476	A230T	probably benign	Het
Phactr4	A	T	4: 132,358,271	*695R	probably null	Het
Pkd1	T	C	17: 24,575,866	S2176P	probably damaging	Het
Plch2	C	A	4: 155,009,086	R133L	probably damaging	Het
Ptprq	G	T	10: 107,685,171	N713K	probably damaging	Het
Ptrh2	A	T	11: 86,689,967	T137S	probably benign	Het
R3hdm1	A	G	1: 128,211,208	Y718C	possibly damaging	Het
Rftn1	T	A	17: 49,994,307	R505*	probably null	Het
Rps15a	A	G	7: 118,109,111	F128L	probably benign	Het
Slc25a25	A	T	2: 32,420,396	M177K	possibly damaging	Het
Smgc	C	A	15: 91,860,294	P631Q	probably damaging	Het
Sox2	T	C	3: 34,651,157	S248P	probably damaging	Het
Sycp1	T	C	3: 102,853,492	K702E	probably damaging	Het
Tes	G	T	6: 17,104,762	C414F	probably damaging	Het
Tet1	A	T	10: 62,814,501	C14S	probably null	Het
Tle3	C	T	9: 61,412,305	P452S	probably damaging	Het
Tmc6	A	C	11: 117,775,844	L131R	possibly damaging	Het
Tnip3	C	T	6: 65,593,511	R30*	probably null	Het
Tnrc6b	G	T	15: 80,929,285	G1748W	probably damaging	Het
Ugt2b38	T	G	5: 87,410,425	D459A	probably damaging	Het
Zdhhc2	A	T	8: 40,467,439	R246S	probably damaging	Het
Zscan22	T	A	7: 12,906,821	C331S	probably damaging	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
G1Funyon:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
R9442:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R9525:Cfap57	UTSW	4	118576581	missense	probably damaging	1.00
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGAGGTTCCAATGGGCAG -3'
(R):5'- TGACAGAGATGCACCAAGGC -3'

Sequencing Primer
(F):5'- CCAATGGGCAGGGTGTG -3'
(R):5'- TTGTCTTTCACAACCTACACAAAAGG -3'

Posted On

2019-06-26