Incidental Mutation 'R7210:Areg'
ID560991
Institutional Source Beutler Lab
Gene Symbol Areg
Ensembl Gene ENSMUSG00000029378
Gene Nameamphiregulin
SynonymsAR, Sdgf
MMRRC Submission
Accession Numbers

MGI: 88068; Ncbi RefSeq: NM_009704

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7210 (G1)
Quality Score216.009
Status Validated
Chromosome5
Chromosomal Location91139599-91148432 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 91140905 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 23 (Y23*)
Ref Sequence ENSEMBL: ENSMUSP00000031325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031325]
Predicted Effect probably null
Transcript: ENSMUST00000031325
AA Change: Y23*
SMART Domains Protein: ENSMUSP00000031325
Gene: ENSMUSG00000029378
AA Change: Y23*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF 138 175 7.41e0 SMART
transmembrane domain 193 215 N/A INTRINSIC
low complexity region 222 240 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a member of the epidermal growth factor (EGF) family and preproprotein that is proteolytically processed to generate a mature protein product. The encoded protein is a ligand of the epidermal growth factor receptor (EGFR) and has been shown to play a role in immunity, inflammation, tissue repair, and lung and mammary gland development. Homozygous knockout mice for this gene exhibit impaired immune system regulation in the skin and gene expression changes characteristic of chronic liver damage. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired development of mammary gland ducts in pubescent females. Mutant ducts show retarded elongation with few terminal end buds. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Areg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Areg APN 5 91141095 missense probably damaging 0.99
IGL01929:Areg APN 5 91144453 missense probably benign
IGL01971:Areg APN 5 91141011 missense probably benign 0.03
IGL02250:Areg APN 5 91141108 missense possibly damaging 0.83
R1436:Areg UTSW 5 91139805 start gained probably benign
R1674:Areg UTSW 5 91143626 missense probably damaging 0.96
R1699:Areg UTSW 5 91143498 missense probably damaging 1.00
R4239:Areg UTSW 5 91143516 missense probably damaging 1.00
R4240:Areg UTSW 5 91143516 missense probably damaging 1.00
R4613:Areg UTSW 5 91143504 missense probably benign 0.34
R4738:Areg UTSW 5 91146724 missense possibly damaging 0.91
R5040:Areg UTSW 5 91144339 missense possibly damaging 0.94
R5305:Areg UTSW 5 91144449 missense probably damaging 1.00
R5987:Areg UTSW 5 91146718 missense possibly damaging 0.83
R6075:Areg UTSW 5 91143597 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGACTGGGAAGTTGCTTC -3'
(R):5'- ACTCACCTCTGACTGAATCATC -3'

Sequencing Primer
(F):5'- AAGTTGCTTCTATGAGCGACTCAG -3'
(R):5'- GTGGTTCATTATCATACTCCTCTGAG -3'
Posted On2019-06-26