Mutagenetix > Incidental Mutation

Incidental Mutation 'R7210:Cnot1'

561003

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

045239-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7210 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95788658 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 25 (Y25C)

Ref Sequence

ENSEMBL: ENSMUSP00000063565 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000212323] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000068452
AA Change: Y25C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: Y25C

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000098473
AA Change: Y25C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: Y25C

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000211887
AA Change: Y25C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212323
AA Change: Y25C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000213006
AA Change: Y25C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

unknown
Transcript: ENSMUST00000213046
AA Change: Y25C

Meta Mutation Damage Score

0.8868

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (60/60)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	G	A	11: 94,373,941	P194S	probably benign	Het
Ackr2	C	T	9: 121,908,877	A106V	possibly damaging	Het
Alg3	G	A	16: 20,605,894	P112L	unknown	Het
Areg	T	A	5: 91,140,905	Y23*	probably null	Het
Aspn	A	G	13: 49,566,491	T328A	probably benign	Het
B020011L13Rik	A	T	1: 117,801,511	E249D	possibly damaging	Het
Bptf	G	A	11: 107,054,464	Q2650*	probably null	Het
Btbd3	A	T	2: 138,283,744	R283W	probably damaging	Het
Cep131	T	C	11: 120,064,789	H1035R	probably damaging	Het
Cfap57	A	T	4: 118,576,703	Y959*	probably null	Het
Crebbp	G	A	16: 4,084,257	H2373Y	possibly damaging	Het
Ctnna3	T	C	10: 64,250,768	L373P	probably damaging	Het
Cyp8b1	T	A	9: 121,915,180	D362V	probably damaging	Het
D430042O09Rik	T	C	7: 125,872,239	V1504A	probably damaging	Het
D630003M21Rik	T	A	2: 158,216,012		probably null	Het
Dpp6	T	C	5: 27,598,803	I249T	probably damaging	Het
Fam149b	T	G	14: 20,378,472	I475M	probably damaging	Het
Fat1	A	G	8: 45,023,503	Y1862C	probably damaging	Het
Fcrl5	A	T	3: 87,446,412	N355Y	possibly damaging	Het
Fgd6	C	T	10: 94,134,092	T1201I	probably damaging	Het
Fndc8	A	T	11: 82,897,866	D174V	probably damaging	Het
Gatb	A	G	3: 85,574,220	H26R	probably benign	Het
Gm37240	T	A	3: 84,497,807	T230S	probably benign	Het
Gria4	T	C	9: 4,464,135	Q609R	probably damaging	Het
Gse1	C	A	8: 120,230,702	T644K	unknown	Het
Ifit1bl1	T	G	19: 34,594,164	I298L	probably benign	Het
Il31ra	T	C	13: 112,549,500	D85G	possibly damaging	Het
Lyst	T	C	13: 13,656,983	L1664P	probably damaging	Het
Mrpl35	A	G	6: 71,817,738	L82S	possibly damaging	Het
Myo7b	G	A	18: 32,007,102	R212C	probably damaging	Het
Myom2	T	C	8: 15,104,114	V684A	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nop58	G	T	1: 59,710,380		probably null	Het
Nudt13	T	A	14: 20,309,784	I193N	possibly damaging	Het
Nyap1	C	A	5: 137,737,982	R81L	probably damaging	Het
Olfr388-ps1	T	C	11: 73,724,873	I50M	possibly damaging	Het
Oxct2b	A	C	4: 123,116,276		probably benign	Het
Pcf11	C	T	7: 92,663,476	A230T	probably benign	Het
Phactr4	A	T	4: 132,358,271	*695R	probably null	Het
Pkd1	T	C	17: 24,575,866	S2176P	probably damaging	Het
Plch2	C	A	4: 155,009,086	R133L	probably damaging	Het
Ptprq	G	T	10: 107,685,171	N713K	probably damaging	Het
Ptrh2	A	T	11: 86,689,967	T137S	probably benign	Het
R3hdm1	A	G	1: 128,211,208	Y718C	possibly damaging	Het
Rftn1	T	A	17: 49,994,307	R505*	probably null	Het
Rps15a	A	G	7: 118,109,111	F128L	probably benign	Het
Slc25a25	A	T	2: 32,420,396	M177K	possibly damaging	Het
Smgc	C	A	15: 91,860,294	P631Q	probably damaging	Het
Sox2	T	C	3: 34,651,157	S248P	probably damaging	Het
Sycp1	T	C	3: 102,853,492	K702E	probably damaging	Het
Tes	G	T	6: 17,104,762	C414F	probably damaging	Het
Tet1	A	T	10: 62,814,501	C14S	probably null	Het
Tle3	C	T	9: 61,412,305	P452S	probably damaging	Het
Tmc6	A	C	11: 117,775,844	L131R	possibly damaging	Het
Tnip3	C	T	6: 65,593,511	R30*	probably null	Het
Tnrc6b	G	T	15: 80,929,285	G1748W	probably damaging	Het
Ugt2b38	T	G	5: 87,410,425	D459A	probably damaging	Het
Zdhhc2	A	T	8: 40,467,439	R246S	probably damaging	Het
Zscan22	T	A	7: 12,906,821	C331S	probably damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
Quorum	UTSW	8	95726118	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9179:Cnot1	UTSW	8	95773426	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	95770710	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	95756226	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	95756207	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	95729246	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	95761391	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	95769581	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	95729144	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TGTGAACGTACCCATAGACTG -3'
(R):5'- TTTCAGAACAGAGTAAGACACTTGG -3'

Sequencing Primer
(F):5'- CGTACCCATAGACTGATATAAGGTC -3'
(R):5'- GACATTTACAGATAACAGAGATAGCC -3'

Posted On

2019-06-26