Incidental Mutation 'R7210:Ctnna3'
ID561010
Institutional Source Beutler Lab
Gene Symbol Ctnna3
Ensembl Gene ENSMUSG00000060843
Gene Namecatenin (cadherin associated protein), alpha 3
SynonymsCatna3, Vr22, alphaT-catenin, 4930429L08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R7210 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location63430098-65003667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64250768 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 373 (L373P)
Ref Sequence ENSEMBL: ENSMUSP00000101081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075099] [ENSMUST00000105440] [ENSMUST00000105441]
Predicted Effect probably damaging
Transcript: ENSMUST00000075099
AA Change: L373P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074606
Gene: ENSMUSG00000060843
AA Change: L373P

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105440
AA Change: L373P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101080
Gene: ENSMUSG00000060843
AA Change: L373P

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105441
AA Change: L373P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101081
Gene: ENSMUSG00000060843
AA Change: L373P

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Meta Mutation Damage Score 0.7893 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the vinculin/alpha-catenin family. The encoded protein plays a role in cell-cell adhesion in muscle cells. Mutations in this gene are associated with arrhythmogenic right ventricular dysplasia, familial 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased heart weight, increased ventricle size, dilated cardiomyopathy and increased susceptibility to ischemia-induced arrhythmias and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Areg T A 5: 91,140,905 Y23* probably null Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Ctnna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ctnna3 APN 10 63566833 missense probably damaging 1.00
IGL00823:Ctnna3 APN 10 63537543 missense possibly damaging 0.68
IGL00963:Ctnna3 APN 10 64945949 missense probably damaging 1.00
IGL01388:Ctnna3 APN 10 63504107 missense possibly damaging 0.67
IGL01655:Ctnna3 APN 10 64873170 missense probably benign 0.01
IGL01783:Ctnna3 APN 10 63820469 missense possibly damaging 0.91
IGL01909:Ctnna3 APN 10 63504131 missense probably benign 0.11
IGL02160:Ctnna3 APN 10 64250698 missense probably benign
IGL02267:Ctnna3 APN 10 64945998 missense probably benign 0.20
IGL02524:Ctnna3 APN 10 64260826 missense possibly damaging 0.68
IGL02707:Ctnna3 APN 10 63504065 missense probably benign
IGL03165:Ctnna3 APN 10 64945941 missense probably damaging 0.98
Bipolar UTSW 10 64873207 missense probably damaging 0.96
Catatonia UTSW 10 64585995 missense probably benign
hebephrenia UTSW 10 64260935 missense probably benign 0.17
multiple UTSW 10 64250768 missense probably damaging 1.00
PIT4687001:Ctnna3 UTSW 10 64834606 missense probably damaging 1.00
R0345:Ctnna3 UTSW 10 63566840 missense probably benign 0.00
R0387:Ctnna3 UTSW 10 64586130 missense probably benign 0.00
R0523:Ctnna3 UTSW 10 64675909 missense probably damaging 0.97
R0647:Ctnna3 UTSW 10 63820424 missense probably benign 0.00
R0676:Ctnna3 UTSW 10 64409261 missense probably benign 0.20
R1102:Ctnna3 UTSW 10 64585995 missense probably benign
R1521:Ctnna3 UTSW 10 64959842 missense probably benign 0.22
R1700:Ctnna3 UTSW 10 63852772 missense probably damaging 1.00
R1874:Ctnna3 UTSW 10 63504107 missense possibly damaging 0.67
R1995:Ctnna3 UTSW 10 63820364 missense probably damaging 0.98
R2088:Ctnna3 UTSW 10 64873207 missense probably damaging 0.96
R2198:Ctnna3 UTSW 10 65002745 missense probably benign 0.00
R4056:Ctnna3 UTSW 10 65002568 missense probably damaging 1.00
R4208:Ctnna3 UTSW 10 64959778 missense probably benign 0.22
R4440:Ctnna3 UTSW 10 64260935 missense probably benign 0.17
R4568:Ctnna3 UTSW 10 63852809 missense possibly damaging 0.56
R4594:Ctnna3 UTSW 10 64586079 missense probably benign 0.32
R4835:Ctnna3 UTSW 10 63581944 missense probably benign 0.01
R4849:Ctnna3 UTSW 10 64873315 missense probably damaging 1.00
R5682:Ctnna3 UTSW 10 64873306 missense probably damaging 0.96
R5777:Ctnna3 UTSW 10 64675885 missense probably benign
R6414:Ctnna3 UTSW 10 64260865 missense probably benign 0.35
R7220:Ctnna3 UTSW 10 64834589 missense probably benign 0.04
R7680:Ctnna3 UTSW 10 64487550 missense probably benign
R7934:Ctnna3 UTSW 10 64585968 missense probably damaging 1.00
R8006:Ctnna3 UTSW 10 63582011 missense probably benign 0.02
R8272:Ctnna3 UTSW 10 65002598 missense probably damaging 1.00
R8415:Ctnna3 UTSW 10 63504130 missense probably benign 0.05
Z1088:Ctnna3 UTSW 10 63581978 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GTGCTCATGAATCATATACAGTGTC -3'
(R):5'- CCTCTGTTTGCCACAAAACATTTGAG -3'

Sequencing Primer
(F):5'- CAGTGTCATAGCAGTTTTGAAAAC -3'
(R):5'- CATTTGAGGCATACGAATGTGG -3'
Posted On2019-06-26