Incidental Mutation 'R7210:Fgd6'
ID 561011
Institutional Source Beutler Lab
Gene Symbol Fgd6
Ensembl Gene ENSMUSG00000020021
Gene Name FYVE, RhoGEF and PH domain containing 6
Synonyms Etohd4, ZFYVE24
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock # R7210 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 94036001-94145339 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 94134092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1201 (T1201I)
Ref Sequence ENSEMBL: ENSMUSP00000020208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020208]
AlphaFold Q69ZL1
PDB Structure Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000020208
AA Change: T1201I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021
AA Change: T1201I

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
RhoGEF 845 1029 3.09e-46 SMART
PH 1060 1155 6.25e-15 SMART
FYVE 1183 1251 6.93e-28 SMART
low complexity region 1268 1282 N/A INTRINSIC
PH 1303 1398 1.54e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Areg T A 5: 91,140,905 Y23* probably null Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Fgd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Fgd6 APN 10 94043634 missense probably benign 0.01
IGL00975:Fgd6 APN 10 94134076 missense probably damaging 0.98
IGL01366:Fgd6 APN 10 94043476 missense possibly damaging 0.71
IGL01940:Fgd6 APN 10 94089650 splice site probably null
IGL01958:Fgd6 APN 10 94138308 missense probably benign 0.25
IGL01988:Fgd6 APN 10 94074335 splice site probably benign
IGL02019:Fgd6 APN 10 94133354 missense probably damaging 1.00
IGL02074:Fgd6 APN 10 94127435 missense probably damaging 1.00
IGL02227:Fgd6 APN 10 94134084 missense probably damaging 1.00
IGL02262:Fgd6 APN 10 94125628 missense probably damaging 0.98
IGL02353:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02360:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02425:Fgd6 APN 10 94074202 missense probably benign 0.00
IGL02526:Fgd6 APN 10 94100511 missense probably benign 0.21
IGL02607:Fgd6 APN 10 94044448 missense possibly damaging 0.94
IGL02741:Fgd6 APN 10 94123290 missense possibly damaging 0.65
IGL02870:Fgd6 APN 10 94045164 missense probably damaging 1.00
IGL02884:Fgd6 APN 10 94045639 splice site probably benign
IGL02995:Fgd6 APN 10 94045480 nonsense probably null
IGL03189:Fgd6 APN 10 94044456 missense probably benign 0.26
IGL03258:Fgd6 APN 10 94133353 missense probably benign 0.44
IGL03396:Fgd6 APN 10 94044456 missense probably benign 0.26
FR4449:Fgd6 UTSW 10 94044320 small deletion probably benign
R0257:Fgd6 UTSW 10 94043915 missense probably benign 0.11
R0926:Fgd6 UTSW 10 94135047 missense probably benign 0.40
R1325:Fgd6 UTSW 10 94127427 missense probably damaging 1.00
R1422:Fgd6 UTSW 10 94045372 missense probably damaging 1.00
R1491:Fgd6 UTSW 10 94044832 missense probably benign 0.06
R1593:Fgd6 UTSW 10 94045032 missense probably damaging 1.00
R1624:Fgd6 UTSW 10 94137436 missense probably benign 0.19
R1929:Fgd6 UTSW 10 94045006 missense probably benign 0.01
R2064:Fgd6 UTSW 10 94045041 missense probably damaging 0.98
R2965:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R2966:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R3889:Fgd6 UTSW 10 94089637 missense probably damaging 1.00
R4094:Fgd6 UTSW 10 94043434 missense probably damaging 1.00
R4605:Fgd6 UTSW 10 94044355 missense probably benign 0.12
R4883:Fgd6 UTSW 10 94139853 missense probably benign 0.00
R5217:Fgd6 UTSW 10 94134077 missense possibly damaging 0.90
R5473:Fgd6 UTSW 10 94044676 missense probably benign 0.00
R5606:Fgd6 UTSW 10 94138328 nonsense probably null
R5644:Fgd6 UTSW 10 94134050 missense possibly damaging 0.80
R6051:Fgd6 UTSW 10 94137565 critical splice donor site probably null
R6258:Fgd6 UTSW 10 94044299 missense probably benign 0.00
R6735:Fgd6 UTSW 10 94074320 missense possibly damaging 0.94
R7181:Fgd6 UTSW 10 94043511 missense probably benign 0.02
R7296:Fgd6 UTSW 10 94044047 nonsense probably null
R7296:Fgd6 UTSW 10 94139881 missense probably benign 0.02
R7697:Fgd6 UTSW 10 94045444 missense probably damaging 0.99
R7747:Fgd6 UTSW 10 94044916 missense probably damaging 1.00
R7861:Fgd6 UTSW 10 94103331 missense probably benign 0.15
R7940:Fgd6 UTSW 10 94120482 missense probably benign 0.02
R8022:Fgd6 UTSW 10 94044344 missense possibly damaging 0.54
R8138:Fgd6 UTSW 10 94134143 missense probably null 0.45
R8171:Fgd6 UTSW 10 94074332 critical splice donor site probably null
R8189:Fgd6 UTSW 10 94074215 missense probably benign 0.00
R8213:Fgd6 UTSW 10 94044052 missense probably benign 0.37
R8960:Fgd6 UTSW 10 94045006 missense probably benign 0.06
R8981:Fgd6 UTSW 10 94045054 missense possibly damaging 0.80
R8989:Fgd6 UTSW 10 94123563 missense probably damaging 0.97
RF031:Fgd6 UTSW 10 94044325 frame shift probably null
RF040:Fgd6 UTSW 10 94044325 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTTGAGAAATGCGCTCGCC -3'
(R):5'- CAGACGACATCTCTGCCTTCAC -3'

Sequencing Primer
(F):5'- CCCTTACTGATGCCATCGG -3'
(R):5'- ACTAGCACTGCCCTTCCTGG -3'
Posted On 2019-06-26