Incidental Mutation 'R7210:Aspn'
ID561020
Institutional Source Beutler Lab
Gene Symbol Aspn
Ensembl Gene ENSMUSG00000021388
Gene Nameasporin
SynonymsPLAP-1, 4631401G09Rik, SLRR1C
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7210 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location49544443-49567565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49566491 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 328 (T328A)
Ref Sequence ENSEMBL: ENSMUSP00000021820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000021820] [ENSMUST00000177948]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021820
AA Change: T328A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021820
Gene: ENSMUSG00000021388
AA Change: T328A

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
LRRNT 67 99 8.23e-6 SMART
LRR 98 117 3.36e2 SMART
LRR 118 141 2.49e-1 SMART
LRR 142 165 5.41e0 SMART
LRR 187 212 9.5e1 SMART
Blast:LRR 232 256 9e-6 BLAST
LRR 257 280 4.83e0 SMART
LRR 281 303 6.23e1 SMART
LRR 304 327 2.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177948
AA Change: T328A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136728
Gene: ENSMUSG00000021388
AA Change: T328A

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
LRRNT 67 99 8.23e-6 SMART
LRR 98 117 3.36e2 SMART
LRR 118 141 2.49e-1 SMART
LRR 142 165 5.41e0 SMART
LRR 187 212 9.5e1 SMART
Blast:LRR 232 256 9e-6 BLAST
LRR 257 280 4.83e0 SMART
LRR 281 303 6.23e1 SMART
LRR 304 327 2.03e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a member of the small leucine-rich proteoglycan family. The encoded protein is an extracellular matrix protein that modulates the transforming growth factor-beta signaling pathway, regulating cartilage matrix gene expression and cartilage formation. The protein plays a role in the pathology of osteoarthritis. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Areg T A 5: 91,140,905 Y23* probably null Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Aspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Aspn APN 13 49566492 missense probably benign 0.06
IGL00796:Aspn APN 13 49557417 missense probably damaging 0.98
IGL01088:Aspn APN 13 49566553 missense probably benign 0.00
IGL02633:Aspn APN 13 49551887 missense possibly damaging 0.93
IGL03180:Aspn APN 13 49563515 missense probably damaging 1.00
PIT4544001:Aspn UTSW 13 49553982 nonsense probably null
R0699:Aspn UTSW 13 49551782 missense possibly damaging 0.63
R1445:Aspn UTSW 13 49557373 missense possibly damaging 0.75
R1749:Aspn UTSW 13 49551785 missense probably benign 0.01
R2907:Aspn UTSW 13 49551898 missense probably damaging 1.00
R3744:Aspn UTSW 13 49566560 missense probably damaging 0.96
R3745:Aspn UTSW 13 49566560 missense probably damaging 0.96
R4625:Aspn UTSW 13 49557425 missense probably benign
R5061:Aspn UTSW 13 49566604 missense probably damaging 0.99
R5712:Aspn UTSW 13 49563519 missense probably damaging 1.00
R7079:Aspn UTSW 13 49566555 missense probably damaging 1.00
R7273:Aspn UTSW 13 49558876 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTATGAGGCCCATGTTCCAG -3'
(R):5'- AGAATCATTCATGTGCAGAAGGAC -3'

Sequencing Primer
(F):5'- TATGAGGCCCATGTTCCAGATAAAAC -3'
(R):5'- ACTACCATTACTAGGACAGTTCAAG -3'
Posted On2019-06-26