Incidental Mutation 'R7210:Fam149b'
ID561023
Institutional Source Beutler Lab
Gene Symbol Fam149b
Ensembl Gene ENSMUSG00000039599
Gene Namefamily with sequence similarity 149, member B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R7210 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location20348162-20383491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 20378472 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 475 (I475M)
Ref Sequence ENSEMBL: ENSMUSP00000087985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051915] [ENSMUST00000090499] [ENSMUST00000090503] [ENSMUST00000225597] [ENSMUST00000225834] [ENSMUST00000225942] [ENSMUST00000225991]
Predicted Effect probably damaging
Transcript: ENSMUST00000051915
AA Change: I346M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056907
Gene: ENSMUSG00000039599
AA Change: I346M

DomainStartEndE-ValueType
Pfam:DUF3719 116 183 2.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090499
AA Change: I475M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087985
Gene: ENSMUSG00000039599
AA Change: I475M

DomainStartEndE-ValueType
Pfam:DUF3719 116 181 1.5e-28 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090503
AA Change: I382M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087989
Gene: ENSMUSG00000039599
AA Change: I382M

DomainStartEndE-ValueType
Pfam:DUF3719 116 157 5.7e-14 PFAM
low complexity region 276 290 N/A INTRINSIC
low complexity region 311 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225597
Predicted Effect probably benign
Transcript: ENSMUST00000225834
Predicted Effect probably damaging
Transcript: ENSMUST00000225942
AA Change: I475M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225991
AA Change: I196M

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Alg3 G A 16: 20,605,894 P112L unknown Het
Areg T A 5: 91,140,905 Y23* probably null Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Fam149b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Fam149b APN 14 20377881 missense possibly damaging 0.78
IGL02323:Fam149b APN 14 20363301 missense possibly damaging 0.94
IGL02631:Fam149b APN 14 20375546 missense probably damaging 0.97
IGL03208:Fam149b APN 14 20351302 splice site probably benign
R0334:Fam149b UTSW 14 20363424 missense probably damaging 0.97
R2511:Fam149b UTSW 14 20378456 missense probably damaging 1.00
R2566:Fam149b UTSW 14 20375510 missense probably damaging 0.97
R4659:Fam149b UTSW 14 20367873 missense probably benign 0.16
R5011:Fam149b UTSW 14 20363371 missense possibly damaging 0.92
R5013:Fam149b UTSW 14 20363371 missense possibly damaging 0.92
R5583:Fam149b UTSW 14 20363300 missense possibly damaging 0.66
R5791:Fam149b UTSW 14 20351326 missense probably damaging 0.96
R5905:Fam149b UTSW 14 20359910 missense probably benign 0.30
R6035:Fam149b UTSW 14 20377917 missense probably damaging 1.00
R6035:Fam149b UTSW 14 20377917 missense probably damaging 1.00
R7180:Fam149b UTSW 14 20381785 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATCTGGGTGGCTTCAAGC -3'
(R):5'- AACATCAGCTGCTGTGGTACC -3'

Sequencing Primer
(F):5'- TTCAAGCCTCCTGAGCACACTG -3'
(R):5'- TGGTACCCACTCCTAAGCAG -3'
Posted On2019-06-26