Mutagenetix > Incidental Mutations

Incidental Mutation 'R7210:Tnrc6b'

561024

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R7210 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 80929285 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Tryptophan at position 1748 (G1748W)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

Predicted Effect

probably damaging
Transcript: ENSMUST00000067689
AA Change: G1748W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: G1748W

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

Meta Mutation Damage Score

0.1142

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (60/60)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	G	A	11: 94,373,941	P194S	probably benign	Het
Ackr2	C	T	9: 121,908,877	A106V	possibly damaging	Het
Alg3	G	A	16: 20,605,894	P112L	unknown	Het
Areg	T	A	5: 91,140,905	Y23*	probably null	Het
Aspn	A	G	13: 49,566,491	T328A	probably benign	Het
B020011L13Rik	A	T	1: 117,801,511	E249D	possibly damaging	Het
Bptf	G	A	11: 107,054,464	Q2650*	probably null	Het
Btbd3	A	T	2: 138,283,744	R283W	probably damaging	Het
Cep131	T	C	11: 120,064,789	H1035R	probably damaging	Het
Cfap57	A	T	4: 118,576,703	Y959*	probably null	Het
Cnot1	T	C	8: 95,788,658	Y25C	probably damaging	Het
Crebbp	G	A	16: 4,084,257	H2373Y	possibly damaging	Het
Ctnna3	T	C	10: 64,250,768	L373P	probably damaging	Het
Cyp8b1	T	A	9: 121,915,180	D362V	probably damaging	Het
D430042O09Rik	T	C	7: 125,872,239	V1504A	probably damaging	Het
D630003M21Rik	T	A	2: 158,216,012		probably null	Het
Dpp6	T	C	5: 27,598,803	I249T	probably damaging	Het
Fam149b	T	G	14: 20,378,472	I475M	probably damaging	Het
Fat1	A	G	8: 45,023,503	Y1862C	probably damaging	Het
Fcrl5	A	T	3: 87,446,412	N355Y	possibly damaging	Het
Fgd6	C	T	10: 94,134,092	T1201I	probably damaging	Het
Fndc8	A	T	11: 82,897,866	D174V	probably damaging	Het
Gatb	A	G	3: 85,574,220	H26R	probably benign	Het
Gm37240	T	A	3: 84,497,807	T230S	probably benign	Het
Gria4	T	C	9: 4,464,135	Q609R	probably damaging	Het
Gse1	C	A	8: 120,230,702	T644K	unknown	Het
Ifit1bl1	T	G	19: 34,594,164	I298L	probably benign	Het
Il31ra	T	C	13: 112,549,500	D85G	possibly damaging	Het
Lyst	T	C	13: 13,656,983	L1664P	probably damaging	Het
Mrpl35	A	G	6: 71,817,738	L82S	possibly damaging	Het
Myo7b	G	A	18: 32,007,102	R212C	probably damaging	Het
Myom2	T	C	8: 15,104,114	V684A	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nop58	G	T	1: 59,710,380		probably null	Het
Nudt13	T	A	14: 20,309,784	I193N	possibly damaging	Het
Nyap1	C	A	5: 137,737,982	R81L	probably damaging	Het
Olfr388-ps1	T	C	11: 73,724,873	I50M	possibly damaging	Het
Oxct2b	A	C	4: 123,116,276		probably benign	Het
Pcf11	C	T	7: 92,663,476	A230T	probably benign	Het
Phactr4	A	T	4: 132,358,271	*695R	probably null	Het
Pkd1	T	C	17: 24,575,866	S2176P	probably damaging	Het
Plch2	C	A	4: 155,009,086	R133L	probably damaging	Het
Ptprq	G	T	10: 107,685,171	N713K	probably damaging	Het
Ptrh2	A	T	11: 86,689,967	T137S	probably benign	Het
R3hdm1	A	G	1: 128,211,208	Y718C	possibly damaging	Het
Rftn1	T	A	17: 49,994,307	R505*	probably null	Het
Rps15a	A	G	7: 118,109,111	F128L	probably benign	Het
Slc25a25	A	T	2: 32,420,396	M177K	possibly damaging	Het
Smgc	C	A	15: 91,860,294	P631Q	probably damaging	Het
Sox2	T	C	3: 34,651,157	S248P	probably damaging	Het
Sycp1	T	C	3: 102,853,492	K702E	probably damaging	Het
Tes	G	T	6: 17,104,762	C414F	probably damaging	Het
Tet1	A	T	10: 62,814,501	C14S	probably null	Het
Tle3	C	T	9: 61,412,305	P452S	probably damaging	Het
Tmc6	A	C	11: 117,775,844	L131R	possibly damaging	Het
Tnip3	C	T	6: 65,593,511	R30*	probably null	Het
Ugt2b38	T	G	5: 87,410,425	D459A	probably damaging	Het
Zdhhc2	A	T	8: 40,467,439	R246S	probably damaging	Het
Zscan22	T	A	7: 12,906,821	C331S	probably damaging	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- CGAGTTTGCCACTGAGGATG -3'
(R):5'- AAGGTCAAGTTAGTGCTGCTG -3'

Sequencing Primer
(F):5'- GGATGAAGTCAGCCGCTTTC -3'
(R):5'- TAAGTTCAGATTGAATCCGACCCTC -3'

Posted On

2019-06-26