Incidental Mutation 'R7210:Alg3'
ID561027
Institutional Source Beutler Lab
Gene Symbol Alg3
Ensembl Gene ENSMUSG00000033809
Gene Nameasparagine-linked glycosylation 3 (alpha-1,3-mannosyltransferase)
SynonymsD16Ertd36e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R7210 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20605374-20611735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20605894 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 112 (P112L)
Ref Sequence ENSEMBL: ENSMUSP00000156234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045918] [ENSMUST00000096197] [ENSMUST00000123774] [ENSMUST00000147867] [ENSMUST00000159780] [ENSMUST00000231362] [ENSMUST00000231386] [ENSMUST00000231387] [ENSMUST00000231471] [ENSMUST00000231531] [ENSMUST00000231749] [ENSMUST00000231904] [ENSMUST00000232319] [ENSMUST00000232451] [ENSMUST00000232458]
Predicted Effect silent
Transcript: ENSMUST00000045918
SMART Domains Protein: ENSMUSP00000045272
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
Pfam:ALG3 47 406 2.5e-145 PFAM
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096197
SMART Domains Protein: ENSMUSP00000093911
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 7.3e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123774
SMART Domains Protein: ENSMUSP00000123378
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127454
SMART Domains Protein: ENSMUSP00000120559
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ALG3 51 118 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147867
Predicted Effect probably benign
Transcript: ENSMUST00000159780
SMART Domains Protein: ENSMUSP00000123727
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 5.5e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231362
Predicted Effect probably benign
Transcript: ENSMUST00000231386
Predicted Effect probably benign
Transcript: ENSMUST00000231387
Predicted Effect probably benign
Transcript: ENSMUST00000231471
Predicted Effect silent
Transcript: ENSMUST00000231531
Predicted Effect unknown
Transcript: ENSMUST00000231749
AA Change: P112L
Predicted Effect probably benign
Transcript: ENSMUST00000231904
Predicted Effect probably benign
Transcript: ENSMUST00000232319
Predicted Effect probably benign
Transcript: ENSMUST00000232451
Predicted Effect silent
Transcript: ENSMUST00000232458
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALG3 family. The encoded protein catalyses the addition of the first dol-P-Man derived mannose in an alpha 1,3 linkage to Man5GlcNAc2-PP-Dol. Defects in this gene have been associated with congenital disorder of glycosylation type Id (CDG-Id) characterized by abnormal N-glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G A 11: 94,373,941 P194S probably benign Het
Ackr2 C T 9: 121,908,877 A106V possibly damaging Het
Areg T A 5: 91,140,905 Y23* probably null Het
Aspn A G 13: 49,566,491 T328A probably benign Het
B020011L13Rik A T 1: 117,801,511 E249D possibly damaging Het
Bptf G A 11: 107,054,464 Q2650* probably null Het
Btbd3 A T 2: 138,283,744 R283W probably damaging Het
Cep131 T C 11: 120,064,789 H1035R probably damaging Het
Cfap57 A T 4: 118,576,703 Y959* probably null Het
Cnot1 T C 8: 95,788,658 Y25C probably damaging Het
Crebbp G A 16: 4,084,257 H2373Y possibly damaging Het
Ctnna3 T C 10: 64,250,768 L373P probably damaging Het
Cyp8b1 T A 9: 121,915,180 D362V probably damaging Het
D430042O09Rik T C 7: 125,872,239 V1504A probably damaging Het
D630003M21Rik T A 2: 158,216,012 probably null Het
Dpp6 T C 5: 27,598,803 I249T probably damaging Het
Fam149b T G 14: 20,378,472 I475M probably damaging Het
Fat1 A G 8: 45,023,503 Y1862C probably damaging Het
Fcrl5 A T 3: 87,446,412 N355Y possibly damaging Het
Fgd6 C T 10: 94,134,092 T1201I probably damaging Het
Fndc8 A T 11: 82,897,866 D174V probably damaging Het
Gatb A G 3: 85,574,220 H26R probably benign Het
Gm37240 T A 3: 84,497,807 T230S probably benign Het
Gria4 T C 9: 4,464,135 Q609R probably damaging Het
Gse1 C A 8: 120,230,702 T644K unknown Het
Ifit1bl1 T G 19: 34,594,164 I298L probably benign Het
Il31ra T C 13: 112,549,500 D85G possibly damaging Het
Lyst T C 13: 13,656,983 L1664P probably damaging Het
Mrpl35 A G 6: 71,817,738 L82S possibly damaging Het
Myo7b G A 18: 32,007,102 R212C probably damaging Het
Myom2 T C 8: 15,104,114 V684A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nop58 G T 1: 59,710,380 probably null Het
Nudt13 T A 14: 20,309,784 I193N possibly damaging Het
Nyap1 C A 5: 137,737,982 R81L probably damaging Het
Olfr388-ps1 T C 11: 73,724,873 I50M possibly damaging Het
Oxct2b A C 4: 123,116,276 probably benign Het
Pcf11 C T 7: 92,663,476 A230T probably benign Het
Phactr4 A T 4: 132,358,271 *695R probably null Het
Pkd1 T C 17: 24,575,866 S2176P probably damaging Het
Plch2 C A 4: 155,009,086 R133L probably damaging Het
Ptprq G T 10: 107,685,171 N713K probably damaging Het
Ptrh2 A T 11: 86,689,967 T137S probably benign Het
R3hdm1 A G 1: 128,211,208 Y718C possibly damaging Het
Rftn1 T A 17: 49,994,307 R505* probably null Het
Rps15a A G 7: 118,109,111 F128L probably benign Het
Slc25a25 A T 2: 32,420,396 M177K possibly damaging Het
Smgc C A 15: 91,860,294 P631Q probably damaging Het
Sox2 T C 3: 34,651,157 S248P probably damaging Het
Sycp1 T C 3: 102,853,492 K702E probably damaging Het
Tes G T 6: 17,104,762 C414F probably damaging Het
Tet1 A T 10: 62,814,501 C14S probably null Het
Tle3 C T 9: 61,412,305 P452S probably damaging Het
Tmc6 A C 11: 117,775,844 L131R possibly damaging Het
Tnip3 C T 6: 65,593,511 R30* probably null Het
Tnrc6b G T 15: 80,929,285 G1748W probably damaging Het
Ugt2b38 T G 5: 87,410,425 D459A probably damaging Het
Zdhhc2 A T 8: 40,467,439 R246S probably damaging Het
Zscan22 T A 7: 12,906,821 C331S probably damaging Het
Other mutations in Alg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Alg3 APN 16 20607858 missense probably damaging 0.96
IGL01121:Alg3 APN 16 20610647 missense probably damaging 1.00
IGL02121:Alg3 APN 16 20606535 missense possibly damaging 0.55
R5487:Alg3 UTSW 16 20607780 missense probably damaging 1.00
R6183:Alg3 UTSW 16 20610641 missense probably benign 0.02
R6655:Alg3 UTSW 16 20609026 missense probably benign 0.22
R6831:Alg3 UTSW 16 20608747 missense probably damaging 0.98
R6890:Alg3 UTSW 16 20605986 missense possibly damaging 0.91
R7122:Alg3 UTSW 16 20607852 missense probably damaging 1.00
R8871:Alg3 UTSW 16 20605934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGAGAAACGGGTCCCAGC -3'
(R):5'- TATCTGAAGCGTGCATGGAAGG -3'

Sequencing Primer
(F):5'- GTCCCAGCCATTTCAAGGTCAG -3'
(R):5'- GCAGAATAGGGTGCTCTTACC -3'
Posted On2019-06-26