Incidental Mutation 'R0594:Or2a7'
ID 56105
Institutional Source Beutler Lab
Gene Symbol Or2a7
Ensembl Gene ENSMUSG00000043605
Gene Name olfactory receptor family 2 subfamily A member 7
Synonyms MOR261-6, GA_x6K02T2P3E9-4384160-4383228, Olfr13
MMRRC Submission 038784-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.437) question?
Stock # R0594 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 43150922-43151854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43151541 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 207 (V207E)
Ref Sequence ENSEMBL: ENSMUSP00000149893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059512] [ENSMUST00000205175] [ENSMUST00000216179]
AlphaFold P34984
Predicted Effect possibly damaging
Transcript: ENSMUST00000059512
AA Change: V207E

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053813
Gene: ENSMUSG00000043605
AA Change: V207E

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4.8e-60 PFAM
Pfam:7TM_GPCR_Srsx 34 218 1.3e-6 PFAM
Pfam:7tm_1 40 289 6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205175
SMART Domains Protein: ENSMUSP00000145490
Gene: ENSMUSG00000071481

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.5e-60 PFAM
Pfam:7tm_1 40 289 3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216179
AA Change: V207E

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 99% (119/120)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,207,744 (GRCm39) V41A probably benign Het
Acad11 A G 9: 103,972,762 (GRCm39) Q367R probably benign Het
Ackr4 A G 9: 103,976,203 (GRCm39) V248A possibly damaging Het
Adamts14 T C 10: 61,038,666 (GRCm39) E945G probably damaging Het
Ano2 A G 6: 125,959,728 (GRCm39) M663V probably damaging Het
Apc2 T A 10: 80,142,090 (GRCm39) C336* probably null Het
Arhgap17 A G 7: 122,893,741 (GRCm39) S560P probably benign Het
Arl5a T C 2: 52,295,026 (GRCm39) D128G probably damaging Het
Atp6v0a2 C A 5: 124,795,046 (GRCm39) R678S probably benign Het
B4galnt2 C A 11: 95,782,735 (GRCm39) A26S probably benign Het
C1qtnf1 A T 11: 118,337,454 (GRCm39) T95S possibly damaging Het
Ccdc188 T A 16: 18,036,784 (GRCm39) F241L probably benign Het
Cdh19 A T 1: 110,853,597 (GRCm39) D281E probably benign Het
Cdk5rap2 T C 4: 70,273,050 (GRCm39) E241G probably damaging Het
Cherp A T 8: 73,216,246 (GRCm39) probably null Het
Cpne9 T A 6: 113,267,361 (GRCm39) probably benign Het
Cthrc1 A T 15: 38,940,537 (GRCm39) R47W possibly damaging Het
Dcaf13 A G 15: 38,986,663 (GRCm39) E145G probably benign Het
Dcaf4 T A 12: 83,584,817 (GRCm39) probably null Het
Dgka A C 10: 128,568,979 (GRCm39) probably benign Het
Dhrs13 T A 11: 77,925,351 (GRCm39) F157L probably damaging Het
Dnajb5 A T 4: 42,956,577 (GRCm39) Y88F probably damaging Het
Dpp8 A G 9: 64,944,280 (GRCm39) T16A probably damaging Het
Dscc1 A T 15: 54,952,448 (GRCm39) I91K possibly damaging Het
Efemp2 T A 19: 5,525,091 (GRCm39) probably benign Het
Elf2 T C 3: 51,163,874 (GRCm39) T504A possibly damaging Het
Elk3 G A 10: 93,101,022 (GRCm39) S243F probably damaging Het
Ell2 A G 13: 75,898,112 (GRCm39) D93G probably damaging Het
Eln G T 5: 134,741,252 (GRCm39) probably benign Het
Eme1 C T 11: 94,541,256 (GRCm39) D189N possibly damaging Het
Epb41l2 A G 10: 25,319,668 (GRCm39) E167G possibly damaging Het
Exoc5 A T 14: 49,273,544 (GRCm39) probably benign Het
Fam170b A G 14: 32,558,271 (GRCm39) K369E unknown Het
Fam187b T A 7: 30,676,579 (GRCm39) C29* probably null Het
Fam20c T C 5: 138,752,392 (GRCm39) S260P possibly damaging Het
Fam216b G A 14: 78,324,114 (GRCm39) A21V possibly damaging Het
Fam98a A T 17: 75,845,482 (GRCm39) Y421* probably null Het
Farp2 T C 1: 93,504,222 (GRCm39) V333A probably damaging Het
Fcgr1 T C 3: 96,199,628 (GRCm39) Y93C probably damaging Het
Fgd2 A T 17: 29,584,526 (GRCm39) I157F probably damaging Het
Frmd4b T A 6: 97,302,387 (GRCm39) probably benign Het
Fut9 T C 4: 25,620,526 (GRCm39) D96G possibly damaging Het
Glt8d1 G A 14: 30,732,367 (GRCm39) probably null Het
Gm7579 T A 7: 141,766,121 (GRCm39) C176S unknown Het
Gmpr2 A G 14: 55,915,445 (GRCm39) E272G probably damaging Het
Grin2b T C 6: 135,710,927 (GRCm39) H873R probably damaging Het
Gtf2i C T 5: 134,271,027 (GRCm39) probably benign Het
Htr3b A T 9: 48,858,931 (GRCm39) V69E probably benign Het
Icam5 A G 9: 20,946,894 (GRCm39) N474S probably benign Het
Itgal T A 7: 126,913,232 (GRCm39) S610T probably damaging Het
Jag1 T A 2: 136,929,000 (GRCm39) I819L probably damaging Het
Kif9 A T 9: 110,340,408 (GRCm39) E467V probably benign Het
Krit1 T C 5: 3,873,694 (GRCm39) L491P possibly damaging Het
Lipo2 T G 19: 33,724,302 (GRCm39) I155L possibly damaging Het
Lmbr1 A G 5: 29,497,207 (GRCm39) F65L possibly damaging Het
Lsp1 G A 7: 142,042,687 (GRCm39) probably benign Het
Mgat5 T A 1: 127,339,985 (GRCm39) D455E probably damaging Het
Mical2 A T 7: 111,917,657 (GRCm39) Y338F probably damaging Het
Mre11a T G 9: 14,726,505 (GRCm39) S396A probably benign Het
Mrtfa G A 15: 80,901,375 (GRCm39) T372I probably damaging Het
Mtarc2 T C 1: 184,573,536 (GRCm39) N121D probably benign Het
Myo3a C T 2: 22,436,370 (GRCm39) probably benign Het
Naca T C 10: 127,876,224 (GRCm39) probably benign Het
Nav1 A T 1: 135,395,381 (GRCm39) I996K possibly damaging Het
Ncbp1 A G 4: 46,170,551 (GRCm39) N742S probably benign Het
Ndufaf3 G A 9: 108,444,122 (GRCm39) A2V probably benign Het
Niban3 C A 8: 72,051,779 (GRCm39) A38E probably benign Het
Ntn5 G T 7: 45,336,105 (GRCm39) A47S probably damaging Het
Or10ag57 T A 2: 87,218,298 (GRCm39) I83N probably damaging Het
Or1e25 G A 11: 73,494,218 (GRCm39) E271K probably benign Het
Or1e32 T C 11: 73,705,443 (GRCm39) H155R probably benign Het
Or6c207 T C 10: 129,105,021 (GRCm39) Y57C possibly damaging Het
Or9i1 G T 19: 13,839,643 (GRCm39) C162F probably benign Het
Otud7a T A 7: 63,377,220 (GRCm39) L203* probably null Het
Pakap A G 4: 57,856,752 (GRCm39) T694A probably benign Het
Pcdhb13 A G 18: 37,576,984 (GRCm39) Y454C probably damaging Het
Pdzph1 C T 17: 59,261,474 (GRCm39) V853M possibly damaging Het
Plec A G 15: 76,056,453 (GRCm39) S4517P probably damaging Het
Pm20d2 C T 4: 33,181,746 (GRCm39) E286K probably damaging Het
Polr2i T A 7: 29,932,170 (GRCm39) probably null Het
Ppp1r12b A G 1: 134,704,217 (GRCm39) L879P probably damaging Het
Prf1 C A 10: 61,139,501 (GRCm39) Y486* probably null Het
Qsox2 T G 2: 26,104,056 (GRCm39) T325P probably damaging Het
Rab1b G T 19: 5,150,684 (GRCm39) probably benign Het
Rbm19 T C 5: 120,266,381 (GRCm39) probably null Het
Rhobtb2 A G 14: 70,031,397 (GRCm39) V576A probably benign Het
Rnps1 G A 17: 24,643,411 (GRCm39) V215M probably damaging Het
Rps11 A G 7: 44,773,706 (GRCm39) probably benign Het
Serpinb3d C T 1: 107,007,077 (GRCm39) M210I probably damaging Het
Sgsm1 T C 5: 113,458,428 (GRCm39) T17A probably benign Het
Slc6a3 A G 13: 73,686,761 (GRCm39) T43A probably damaging Het
Sox4 C G 13: 29,136,887 (GRCm39) A40P probably damaging Het
Spry2 A T 14: 106,130,744 (GRCm39) D147E possibly damaging Het
Stpg1 A G 4: 135,246,742 (GRCm39) N157D possibly damaging Het
Sumf1 T C 6: 108,150,375 (GRCm39) D152G probably benign Het
Tbr1 T C 2: 61,641,964 (GRCm39) S410P possibly damaging Het
Tdrd6 A G 17: 43,940,274 (GRCm39) V258A probably damaging Het
Tirap C T 9: 35,100,057 (GRCm39) G209D probably damaging Het
Tnfrsf8 A T 4: 145,023,431 (GRCm39) V134D probably damaging Het
Tnr A G 1: 159,677,905 (GRCm39) T97A probably benign Het
Tspan32 T A 7: 142,569,347 (GRCm39) F135L probably damaging Het
Ttn T C 2: 76,619,400 (GRCm39) K16021E probably damaging Het
Tusc3 T A 8: 39,564,122 (GRCm39) I251N probably damaging Het
Usp38 A T 8: 81,731,995 (GRCm39) I305N probably damaging Het
Usp4 T A 9: 108,248,080 (GRCm39) probably null Het
Usp5 A T 6: 124,794,387 (GRCm39) D764E probably damaging Het
Vangl2 A T 1: 171,832,224 (GRCm39) V544E probably damaging Het
Vldlr G A 19: 27,212,219 (GRCm39) V78M probably damaging Het
Vmn1r29 T C 6: 58,284,757 (GRCm39) V159A probably benign Het
Vmn2r16 T A 5: 109,511,762 (GRCm39) F656L probably damaging Het
Wdfy3 T A 5: 102,054,051 (GRCm39) I1590F possibly damaging Het
Xpo1 T A 11: 23,230,402 (GRCm39) V263E probably damaging Het
Zbtb38 A G 9: 96,568,007 (GRCm39) S1026P probably damaging Het
Zfp407 A T 18: 84,580,692 (GRCm39) D140E possibly damaging Het
Zfp637 T A 6: 117,822,647 (GRCm39) Y258* probably null Het
Zfp951 T A 5: 104,962,438 (GRCm39) Q376L possibly damaging Het
Other mutations in Or2a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
N/A - 293:Or2a7 UTSW 6 43,151,493 (GRCm39) missense probably benign 0.45
R0279:Or2a7 UTSW 6 43,151,692 (GRCm39) missense probably benign 0.03
R0669:Or2a7 UTSW 6 43,150,938 (GRCm39) missense probably benign 0.36
R1339:Or2a7 UTSW 6 43,151,544 (GRCm39) missense probably benign 0.39
R1371:Or2a7 UTSW 6 43,151,234 (GRCm39) missense probably benign 0.01
R1669:Or2a7 UTSW 6 43,151,755 (GRCm39) missense probably damaging 1.00
R1832:Or2a7 UTSW 6 43,151,834 (GRCm39) missense probably benign
R2136:Or2a7 UTSW 6 43,151,435 (GRCm39) missense probably benign
R4358:Or2a7 UTSW 6 43,151,160 (GRCm39) missense probably damaging 0.97
R4755:Or2a7 UTSW 6 43,150,977 (GRCm39) missense probably benign 0.00
R4933:Or2a7 UTSW 6 43,151,255 (GRCm39) missense probably benign 0.22
R5504:Or2a7 UTSW 6 43,151,572 (GRCm39) nonsense probably null
R5677:Or2a7 UTSW 6 43,151,265 (GRCm39) missense probably benign 0.35
R5917:Or2a7 UTSW 6 43,151,646 (GRCm39) missense probably damaging 1.00
R6287:Or2a7 UTSW 6 43,151,369 (GRCm39) missense probably benign 0.00
R6480:Or2a7 UTSW 6 43,151,000 (GRCm39) missense probably benign 0.05
R7020:Or2a7 UTSW 6 43,151,096 (GRCm39) missense possibly damaging 0.91
R7240:Or2a7 UTSW 6 43,151,435 (GRCm39) missense probably benign
R8925:Or2a7 UTSW 6 43,151,669 (GRCm39) missense probably benign 0.44
R8927:Or2a7 UTSW 6 43,151,669 (GRCm39) missense probably benign 0.44
R9652:Or2a7 UTSW 6 43,150,991 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGTTACTCTGCCATCATGAGCTG -3'
(R):5'- ACTTGTCACAAAGCTCTCTGTGTCC -3'

Sequencing Primer
(F):5'- TGGAGAGTTTGCAGCACC -3'
(R):5'- TTCACGTCAGAATTCCTGAGAC -3'
Posted On 2013-07-11