Incidental Mutation 'R7211:Prr14l'
ID 561057
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Name proline rich 14-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R7211 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 32789820-32854256 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32830087 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 688 (Q688L)
Ref Sequence ENSEMBL: ENSMUSP00000113259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]
AlphaFold E9Q7C4
Predicted Effect probably damaging
Transcript: ENSMUST00000120129
AA Change: Q688L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: Q688L

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155392
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G T 9: 51,290,433 Q108K probably damaging Het
9930021J03Rik A G 19: 29,786,312 F121S Het
a T A 2: 155,045,779 V53E probably damaging Het
A1cf A G 19: 31,927,141 Y268C probably benign Het
Adamts13 C T 2: 26,989,298 T621I probably benign Het
AI464131 A G 4: 41,498,028 I534T probably damaging Het
Akr1b7 A T 6: 34,421,114 N293Y probably benign Het
Angpt2 T A 8: 18,741,131 T50S probably benign Het
Anks1b C A 10: 90,511,070 A744D possibly damaging Het
Aqr A G 2: 114,134,723 V587A probably benign Het
Atm A G 9: 53,488,560 V1540A probably benign Het
BC022687 T A 12: 112,811,012 probably null Het
C4b A G 17: 34,735,534 V887A possibly damaging Het
Cd200r1 A G 16: 44,788,757 T26A probably benign Het
Ciao1 A G 2: 127,247,008 probably null Het
Clca3a2 A G 3: 144,814,014 C200R probably benign Het
Col6a5 T A 9: 105,928,164 Q1181L unknown Het
Copb2 T A 9: 98,574,145 I244N probably damaging Het
Cpb2 A G 14: 75,274,990 Y281C probably damaging Het
Disp3 C A 4: 148,241,522 V1260F probably damaging Het
Dnajc2 C T 5: 21,776,779 R123Q probably damaging Het
Dpysl2 T C 14: 66,829,976 N162S probably damaging Het
Dsp T A 13: 38,188,535 probably null Het
Edc4 T A 8: 105,886,309 probably null Het
Epm2a T C 10: 11,343,675 Y69H probably benign Het
Frzb C A 2: 80,418,325 E262* probably null Het
Gaa T C 11: 119,284,204 V877A possibly damaging Het
Gm11639 C A 11: 104,710,713 A284D probably benign Het
Gm11639 G T 11: 104,724,609 probably null Het
Gm5346 T A 8: 43,625,877 S437C probably damaging Het
Gpnmb T C 6: 49,052,015 I489T possibly damaging Het
Gpr31b T C 17: 13,052,217 T22A probably benign Het
Gys1 T A 7: 45,448,260 F477Y possibly damaging Het
Hoxc11 A C 15: 102,955,052 E176A possibly damaging Het
Kcnk13 T A 12: 100,061,817 F384I probably damaging Het
Ky A G 9: 102,509,150 E59G probably benign Het
Lama4 T A 10: 39,005,495 D93E probably damaging Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Lrrc71 G T 3: 87,743,326 Q210K possibly damaging Het
Map1a G A 2: 121,304,643 R1980H probably benign Het
Med15 T C 16: 17,698,113 D15G unknown Het
Mfng A T 15: 78,773,068 S69T probably benign Het
Muc16 T G 9: 18,498,570 S181R probably damaging Het
Mug1 A T 6: 121,880,539 Q1074L possibly damaging Het
Nbea T A 3: 56,004,901 N1155I probably benign Het
Nbeal1 T G 1: 60,200,951 L159V probably damaging Het
Nudt1 C A 5: 140,337,647 P118Q possibly damaging Het
Olfr450 A T 6: 42,818,016 T182S probably benign Het
Olfr970 A C 9: 39,819,858 Q73P possibly damaging Het
Pcdhga6 T A 18: 37,709,120 V631D probably benign Het
Pcna A C 2: 132,249,872 V203G probably damaging Het
Pgf G T 12: 85,175,775 N33K probably benign Het
Pgm1 T C 5: 64,105,850 L280P probably damaging Het
Plcg1 G A 2: 160,731,874 A20T probably benign Het
Prdx5 G T 19: 6,907,590 D126E probably damaging Het
Prkag2 T C 5: 24,995,298 T20A probably benign Het
Pxdn T G 12: 29,984,904 D253E possibly damaging Het
Rbm18 A T 2: 36,122,893 C53* probably null Het
Rprm A T 2: 54,085,258 L16Q probably benign Het
Saysd1 A G 14: 20,077,508 F116S probably damaging Het
Scg3 A G 9: 75,682,084 S96P probably benign Het
Scgb1b3 C T 7: 31,375,653 L16F unknown Het
Sh3tc2 A G 18: 61,989,403 T412A probably benign Het
Skint6 T C 4: 113,238,369 N31S probably benign Het
Slc22a2 T C 17: 12,586,883 probably null Het
Slc8a2 C T 7: 16,140,613 T262I possibly damaging Het
Smarcc1 A T 9: 110,150,014 K188N probably damaging Het
Taf6 T C 5: 138,178,826 T660A possibly damaging Het
Tbx2 C T 11: 85,834,714 R164C probably damaging Het
Tec T C 5: 72,782,012 D220G probably null Het
Tfec A T 6: 16,867,465 W59R probably damaging Het
Tmtc2 G T 10: 105,573,726 S8R probably benign Het
Tmtc3 A T 10: 100,447,605 M696K probably benign Het
Trpc3 A T 3: 36,640,733 S691T possibly damaging Het
Ttf2 A T 3: 100,959,307 M503K probably benign Het
Ttll7 A G 3: 146,913,276 H312R probably damaging Het
Ttn T C 2: 76,767,688 Y19627C probably damaging Het
Ugt2b35 T C 5: 87,001,318 S143P probably benign Het
Usp53 A G 3: 122,957,650 S253P probably damaging Het
Utp18 A G 11: 93,885,380 V93A probably benign Het
Utrn T C 10: 12,401,335 N3413D possibly damaging Het
Zhx1 T C 15: 58,053,251 D533G possibly damaging Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
Polymer UTSW 5 32827145 missense probably benign 0.34
Postwar UTSW 5 32830684 missense probably benign 0.17
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 splice site probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
R7164:Prr14l UTSW 5 32829166 missense probably damaging 1.00
R7203:Prr14l UTSW 5 32827145 missense probably benign 0.34
R7305:Prr14l UTSW 5 32831101 missense probably benign 0.14
R7346:Prr14l UTSW 5 32830684 missense probably benign 0.17
R7395:Prr14l UTSW 5 32828638 missense probably benign 0.00
R7624:Prr14l UTSW 5 32829623 missense possibly damaging 0.54
R7649:Prr14l UTSW 5 32828245 missense probably benign 0.18
R7753:Prr14l UTSW 5 32827253 missense probably damaging 1.00
R7828:Prr14l UTSW 5 32844391 intron probably benign
R7898:Prr14l UTSW 5 32829966 missense probably benign 0.04
R8071:Prr14l UTSW 5 32831164 missense probably benign 0.02
R9052:Prr14l UTSW 5 32830134 nonsense probably null
R9136:Prr14l UTSW 5 32828736 missense
Predicted Primers PCR Primer
(F):5'- AAGCAGTCCTTCATCACCAG -3'
(R):5'- AAATGACTGCTGTACATTCCACG -3'

Sequencing Primer
(F):5'- CATCACCAGTTTCCATGTGAGTGG -3'
(R):5'- CACAGAGTGTCAAAATGTTCAGTCTC -3'
Posted On 2019-06-26