Incidental Mutation 'R7211:C4b'
ID561109
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7211 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34735534 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 887 (V887A)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069507
AA Change: V887A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: V887A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (84/85)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G T 9: 51,290,433 Q108K probably damaging Het
9930021J03Rik A G 19: 29,786,312 F121S Het
a T A 2: 155,045,779 V53E probably damaging Het
A1cf A G 19: 31,927,141 Y268C probably benign Het
Adamts13 C T 2: 26,989,298 T621I probably benign Het
AI464131 A G 4: 41,498,028 I534T probably damaging Het
Akr1b7 A T 6: 34,421,114 N293Y probably benign Het
Angpt2 T A 8: 18,741,131 T50S probably benign Het
Anks1b C A 10: 90,511,070 A744D possibly damaging Het
Aqr A G 2: 114,134,723 V587A probably benign Het
Atm A G 9: 53,488,560 V1540A probably benign Het
BC022687 T A 12: 112,811,012 probably null Het
Cd200r1 A G 16: 44,788,757 T26A probably benign Het
Ciao1 A G 2: 127,247,008 probably null Het
Clca3a2 A G 3: 144,814,014 C200R probably benign Het
Col6a5 T A 9: 105,928,164 Q1181L unknown Het
Copb2 T A 9: 98,574,145 I244N probably damaging Het
Cpb2 A G 14: 75,274,990 Y281C probably damaging Het
Disp3 C A 4: 148,241,522 V1260F probably damaging Het
Dnajc2 C T 5: 21,776,779 R123Q probably damaging Het
Dpysl2 T C 14: 66,829,976 N162S probably damaging Het
Dsp T A 13: 38,188,535 probably null Het
Edc4 T A 8: 105,886,309 probably null Het
Epm2a T C 10: 11,343,675 Y69H probably benign Het
Frzb C A 2: 80,418,325 E262* probably null Het
Gaa T C 11: 119,284,204 V877A possibly damaging Het
Gm11639 G T 11: 104,724,609 probably null Het
Gm11639 C A 11: 104,710,713 A284D probably benign Het
Gm5346 T A 8: 43,625,877 S437C probably damaging Het
Gpnmb T C 6: 49,052,015 I489T possibly damaging Het
Gpr31b T C 17: 13,052,217 T22A probably benign Het
Gys1 T A 7: 45,448,260 F477Y possibly damaging Het
Hoxc11 A C 15: 102,955,052 E176A possibly damaging Het
Kcnk13 T A 12: 100,061,817 F384I probably damaging Het
Ky A G 9: 102,509,150 E59G probably benign Het
Lama4 T A 10: 39,005,495 D93E probably damaging Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Lrrc71 G T 3: 87,743,326 Q210K possibly damaging Het
Map1a G A 2: 121,304,643 R1980H probably benign Het
Med15 T C 16: 17,698,113 D15G unknown Het
Mfng A T 15: 78,773,068 S69T probably benign Het
Muc16 T G 9: 18,498,570 S181R probably damaging Het
Mug1 A T 6: 121,880,539 Q1074L possibly damaging Het
Nbea T A 3: 56,004,901 N1155I probably benign Het
Nbeal1 T G 1: 60,200,951 L159V probably damaging Het
Nudt1 C A 5: 140,337,647 P118Q possibly damaging Het
Olfr450 A T 6: 42,818,016 T182S probably benign Het
Olfr970 A C 9: 39,819,858 Q73P possibly damaging Het
Pcdhga6 T A 18: 37,709,120 V631D probably benign Het
Pcna A C 2: 132,249,872 V203G probably damaging Het
Pgf G T 12: 85,175,775 N33K probably benign Het
Pgm1 T C 5: 64,105,850 L280P probably damaging Het
Plcg1 G A 2: 160,731,874 A20T probably benign Het
Prdx5 G T 19: 6,907,590 D126E probably damaging Het
Prkag2 T C 5: 24,995,298 T20A probably benign Het
Prr14l T A 5: 32,830,087 Q688L probably damaging Het
Pxdn T G 12: 29,984,904 D253E possibly damaging Het
Rbm18 A T 2: 36,122,893 C53* probably null Het
Rprm A T 2: 54,085,258 L16Q probably benign Het
Saysd1 A G 14: 20,077,508 F116S probably damaging Het
Scg3 A G 9: 75,682,084 S96P probably benign Het
Scgb1b3 C T 7: 31,375,653 L16F unknown Het
Sh3tc2 A G 18: 61,989,403 T412A probably benign Het
Skint6 T C 4: 113,238,369 N31S probably benign Het
Slc22a2 T C 17: 12,586,883 probably null Het
Slc8a2 C T 7: 16,140,613 T262I possibly damaging Het
Smarcc1 A T 9: 110,150,014 K188N probably damaging Het
Taf6 T C 5: 138,178,826 T660A possibly damaging Het
Tbx2 C T 11: 85,834,714 R164C probably damaging Het
Tec T C 5: 72,782,012 D220G probably null Het
Tfec A T 6: 16,867,465 W59R probably damaging Het
Tmtc2 G T 10: 105,573,726 S8R probably benign Het
Tmtc3 A T 10: 100,447,605 M696K probably benign Het
Trpc3 A T 3: 36,640,733 S691T possibly damaging Het
Ttf2 A T 3: 100,959,307 M503K probably benign Het
Ttll7 A G 3: 146,913,276 H312R probably damaging Het
Ttn T C 2: 76,767,688 Y19627C probably damaging Het
Ugt2b35 T C 5: 87,001,318 S143P probably benign Het
Usp53 A G 3: 122,957,650 S253P probably damaging Het
Utp18 A G 11: 93,885,380 V93A probably benign Het
Utrn T C 10: 12,401,335 N3413D possibly damaging Het
Zhx1 T C 15: 58,053,251 D533G possibly damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
Peroration UTSW 17 34729399 critical splice donor site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7923:C4b UTSW 17 34742380 missense probably damaging 1.00
R7960:C4b UTSW 17 34741278 splice site probably null
R8420:C4b UTSW 17 34734539 missense probably damaging 0.97
R8467:C4b UTSW 17 34732813 missense possibly damaging 0.51
R8558:C4b UTSW 17 34736567 missense probably damaging 1.00
R8725:C4b UTSW 17 34734485 missense probably damaging 1.00
R8727:C4b UTSW 17 34734485 missense probably damaging 1.00
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAATGTTAAATGGCTGGGAGTCCG -3'
(R):5'- ATGTGGCTGTGAGACCGTAG -3'

Sequencing Primer
(F):5'- TCTTAGACACAGCATCCC -3'
(R):5'- TAGGGGAGCCTGAGCATC -3'
Posted On2019-06-26