Mutagenetix > Incidental Mutations

Incidental Mutation 'R7212:Itgb6'

561119

Institutional Source

Beutler Lab

Gene Symbol

Itgb6

Ensembl Gene

ENSMUSG00000026971

Gene Name

integrin beta 6

Synonyms

4831415H04Rik, 2210409C20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.927) question?

Stock #

R7212 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60598292-60722643 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60634654 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 345 (I345V)

Ref Sequence

ENSEMBL: ENSMUSP00000028348 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028348] [ENSMUST00000059888] [ENSMUST00000112517] [ENSMUST00000154764]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028348
AA Change: I345V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000028348
Gene: ENSMUSG00000026971
AA Change: I345V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PSI	22	71	2.19e-9	SMART
INB	30	454	1.84e-277	SMART
VWA	132	365	1.11e-1	SMART
internal_repeat_1	484	538	1.59e-8	PROSPERO
EGF_like	543	575	6.15e1	SMART
Integrin_B_tail	624	706	1.07e-19	SMART
Integrin_b_cyt	730	776	7.82e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000059888
AA Change: I345V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000054944
Gene: ENSMUSG00000026971
AA Change: I345V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PSI	22	71	2.19e-9	SMART
INB	30	454	1.84e-277	SMART
VWA	132	365	1.11e-1	SMART
internal_repeat_1	484	538	1.59e-8	PROSPERO
EGF_like	543	575	6.15e1	SMART
Integrin_B_tail	624	706	1.07e-19	SMART
Integrin_b_cyt	730	776	7.82e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112517
AA Change: I345V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108136
Gene: ENSMUSG00000026971
AA Change: I345V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PSI	22	71	2.19e-9	SMART
INB	30	454	1.84e-277	SMART
VWA	132	365	1.11e-1	SMART
internal_repeat_1	484	538	1.81e-8	PROSPERO
EGF_like	543	575	6.15e1	SMART
Integrin_B_tail	624	706	1.07e-19	SMART
Integrin_b_cyt	730	759	2.38e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000154764
AA Change: I345V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117815
Gene: ENSMUSG00000026971
AA Change: I345V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PSI	22	71	2.19e-9	SMART
INB	30	454	1.84e-277	SMART
VWA	132	365	1.11e-1	SMART
internal_repeat_1	484	538	1.62e-8	PROSPERO
EGF_like	543	575	6.15e1	SMART
Integrin_B_tail	624	706	1.07e-19	SMART
Integrin_b_cyt	730	755	2.3e0	SMART

Meta Mutation Damage Score

0.3202

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms a dimer with an alpha v chain and this heterodimer can bind to ligands like fibronectin and transforming growth factor beta 1. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit baldness associated with macrophage infiltration of skin, exaggerated pulmonary inflammation, and an impaired mucosal mast cell response to nematode infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	C	T	6: 83,161,672	A193V	probably benign	Het
4932438A13Rik	C	A	3: 37,048,009	N1363K		Het
Aatf	C	T	11: 84,449,180	R435Q	probably damaging	Het
Abca13	A	G	11: 9,298,854	H2867R	probably benign	Het
Abcd2	C	T	15: 91,159,123	A621T	possibly damaging	Het
Actl11	T	A	9: 107,928,657	S60T	probably damaging	Het
Adam28	T	A	14: 68,637,397	N277I	probably damaging	Het
Adamts13	T	A	2: 27,006,314	C1240S	probably damaging	Het
Arhgap27	C	T	11: 103,360,755	R49Q	probably damaging	Het
Arhgap8	T	G	15: 84,745,792	L108R	probably null	Het
Armc10	T	C	5: 21,660,583	S209P	probably damaging	Het
Atp6v0a1	T	C	11: 101,043,957	F617L	probably benign	Het
Bap1	T	A	14: 31,251,623	N2K	probably damaging	Het
Cass4	T	A	2: 172,427,186	L396*	probably null	Het
Ccdc40	A	G	11: 119,264,444	Q1170R	probably damaging	Het
Cdhr5	C	T	7: 141,272,659	R348H	probably damaging	Het
Cenpj	A	G	14: 56,552,652	S647P	probably benign	Het
Chordc1	T	A	9: 18,295,351		probably null	Het
Chordc1	T	C	9: 18,301,012	S41P	probably damaging	Het
Ckm	T	C	7: 19,415,053		probably null	Het
Clca1	A	C	3: 145,005,966	I756S	probably damaging	Het
Clcn1	T	C	6: 42,291,389	V165A	possibly damaging	Het
Clec4a4	T	A	6: 122,991,745		probably null	Het
Cog7	T	C	7: 121,977,314	K130E	probably damaging	Het
Coq7	A	G	7: 118,510,048	I259T	unknown	Het
Cp	T	C	3: 19,974,966	S536P	probably damaging	Het
Cyp2d10	T	A	15: 82,404,246		probably null	Het
Dcst2	A	G	3: 89,366,300	I162V	probably benign	Het
Dennd4c	A	G	4: 86,802,991	E630G	probably damaging	Het
Dpt	A	T	1: 164,796,915	I62F	probably benign	Het
Ednrb	T	A	14: 103,843,008	I157F	probably damaging	Het
Ext1	A	T	15: 53,345,162	W68R	probably benign	Het
Fgf4	A	G	7: 144,862,786	K152E	probably benign	Het
G530012D18Rik	A	T	1: 85,577,143	T90S	unknown	Het
Galnt17	T	C	5: 130,964,111	T322A	possibly damaging	Het
Gcm1	A	T	9: 78,059,643	D48V	possibly damaging	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Gm49358	G	T	10: 86,825,207	R353L	probably damaging	Het
Golga4	A	G	9: 118,536,840	E320G	possibly damaging	Het
Herc3	T	C	6: 58,918,773	I1002T	probably damaging	Het
Hip1r	T	A	5: 123,973,782	V7E	possibly damaging	Het
Hipk1	G	A	3: 103,777,610	Q230*	probably null	Het
Igsf9b	C	T	9: 27,331,696	P726L	probably damaging	Het
Lhx4	G	T	1: 155,724,953	Q29K	probably benign	Het
Manba	A	G	3: 135,567,635	T777A	probably benign	Het
Mcm3ap	A	G	10: 76,501,311	D1360G	probably benign	Het
Meltf	T	A	16: 31,890,814		probably null	Het
Mmp14	T	G	14: 54,435,879	D81E	probably damaging	Het
Naalad2	T	C	9: 18,364,041		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Olfr1354	A	T	10: 78,917,505	I222L	possibly damaging	Het
Olfr881	T	A	9: 37,992,957	M150K	possibly damaging	Het
Pacs2	A	G	12: 113,061,692	D488G	possibly damaging	Het
Psg23	A	G	7: 18,607,139	S397P	probably benign	Het
Rfpl4	C	A	7: 5,110,660	R174L	probably damaging	Het
Runx3	T	A	4: 135,152,779	I3N	probably damaging	Het
Scn5a	A	T	9: 119,543,385	N214K	possibly damaging	Het
Slc27a1	T	C	8: 71,584,448	I412T	probably damaging	Het
Sptbn4	T	G	7: 27,416,785	T530P	probably benign	Het
Tex15	A	T	8: 33,570,826	R95*	probably null	Het
Tex15	T	C	8: 33,572,995	S818P	probably damaging	Het
Tmod1	A	T	4: 46,093,951	K221*	probably null	Het
Tpm3	G	A	3: 90,091,054	D272N	probably benign	Het
Trpm6	T	C	19: 18,853,791	V1340A	probably benign	Het
Ugt2b5	A	T	5: 87,125,272	C512S	probably benign	Het
Vmn2r82	A	T	10: 79,379,434	E417V	probably benign	Het
Wfdc11	T	C	2: 164,664,446	N60S	probably benign	Het
Zfp217	A	T	2: 170,114,152	S975R	probably benign	Het
Zfr	C	T	15: 12,146,223	Q287*	probably null	Het

Other mutations in Itgb6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Itgb6	APN	2	60620352	missense	probably benign	0.07
IGL01363:Itgb6	APN	2	60611382	missense	possibly damaging	0.89
IGL01810:Itgb6	APN	2	60627985	missense	probably benign	0.19
IGL02026:Itgb6	APN	2	60628066	missense	possibly damaging	0.79
IGL02347:Itgb6	APN	2	60611412	missense	probably benign
R0372:Itgb6	UTSW	2	60627841	missense	probably benign	0.28
R0533:Itgb6	UTSW	2	60669197	missense	probably benign	0.22
R0542:Itgb6	UTSW	2	60605136	missense	possibly damaging	0.53
R1037:Itgb6	UTSW	2	60650068	missense	probably damaging	1.00
R1191:Itgb6	UTSW	2	60653137	splice site	probably null
R1775:Itgb6	UTSW	2	60672644	nonsense	probably null
R1802:Itgb6	UTSW	2	60653281	missense	probably benign	0.22
R1934:Itgb6	UTSW	2	60669149	missense	probably benign	0.05
R2847:Itgb6	UTSW	2	60600535	missense	probably damaging	1.00
R3934:Itgb6	UTSW	2	60611411	missense	possibly damaging	0.89
R5603:Itgb6	UTSW	2	60620362	missense	probably benign	0.03
R6255:Itgb6	UTSW	2	60605276	missense	probably damaging	1.00
R6571:Itgb6	UTSW	2	60628456	missense	probably damaging	1.00
R6908:Itgb6	UTSW	2	60650021	missense	probably benign	0.02
R7010:Itgb6	UTSW	2	60649978	missense	probably damaging	1.00
R7259:Itgb6	UTSW	2	60650011	missense	probably damaging	1.00
R7300:Itgb6	UTSW	2	60605306	missense	probably benign	0.04
R7491:Itgb6	UTSW	2	60620376	missense	probably damaging	1.00
R7532:Itgb6	UTSW	2	60669213	missense	probably benign
X0018:Itgb6	UTSW	2	60672666	missense	possibly damaging	0.88
Z1088:Itgb6	UTSW	2	60620211	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GGATGAACAGTGCTTCCACAAAC -3'
(R):5'- GGTCTAAATCCCAGCTGTGG -3'

Sequencing Primer
(F):5'- GTGCTTCCACAAACAAACGG -3'
(R):5'- TATGACAAACATAGATTCCCCAGTGG -3'

Posted On

2019-06-26