Mutagenetix > Incidental Mutation

Incidental Mutation 'R7212:Clca1'

561129

Institutional Source

Beutler Lab

Gene Symbol

Clca1

Ensembl Gene

ENSMUSG00000028255

Gene Name

chloride channel accessory 1

Synonyms

gob-5, gob5, Clca3

MMRRC Submission

045340-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R7212 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145003817-145032776 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 145005966 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 756 (I756S)

Ref Sequence

ENSEMBL: ENSMUSP00000029919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029919]

AlphaFold

Q9D7Z6

Predicted Effect

probably damaging
Transcript: ENSMUST00000029919
AA Change: I756S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029919
Gene: ENSMUSG00000028255
AA Change: I756S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	285	297	N/A	INTRINSIC
VWA	305	478	5.05e-19	SMART
Blast:FN3	753	852	2e-28	BLAST

Meta Mutation Damage Score

0.4921

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same region on chromosome 1p31-p22 and share a high degree of homology in size, sequence, and predicted structure, but differ significantly in their tissue distributions. The encoded protein is expressed as a precursor protein that is processed into two cell-surface-associated subunits, although the site at which the precursor is cleaved has not been precisely determined. The encoded protein may be involved in mediating calcium-activated chloride conductance in the intestine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated mucin response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	C	T	6: 83,161,672	A193V	probably benign	Het
4932438A13Rik	C	A	3: 37,048,009	N1363K		Het
Aatf	C	T	11: 84,449,180	R435Q	probably damaging	Het
Abca13	A	G	11: 9,298,854	H2867R	probably benign	Het
Abcd2	C	T	15: 91,159,123	A621T	possibly damaging	Het
Actl11	T	A	9: 107,928,657	S60T	probably damaging	Het
Adam28	T	A	14: 68,637,397	N277I	probably damaging	Het
Adamts13	T	A	2: 27,006,314	C1240S	probably damaging	Het
Arhgap27	C	T	11: 103,360,755	R49Q	probably damaging	Het
Arhgap8	T	G	15: 84,745,792	L108R	probably null	Het
Armc10	T	C	5: 21,660,583	S209P	probably damaging	Het
Atp6v0a1	T	C	11: 101,043,957	F617L	probably benign	Het
Bap1	T	A	14: 31,251,623	N2K	probably damaging	Het
Cass4	T	A	2: 172,427,186	L396*	probably null	Het
Ccdc40	A	G	11: 119,264,444	Q1170R	probably damaging	Het
Cdhr5	C	T	7: 141,272,659	R348H	probably damaging	Het
Cenpj	A	G	14: 56,552,652	S647P	probably benign	Het
Chordc1	T	A	9: 18,295,351		probably null	Het
Chordc1	T	C	9: 18,301,012	S41P	probably damaging	Het
Ckm	T	C	7: 19,415,053		probably null	Het
Clcn1	T	C	6: 42,291,389	V165A	possibly damaging	Het
Clec4a4	T	A	6: 122,991,745		probably null	Het
Cog7	T	C	7: 121,977,314	K130E	probably damaging	Het
Coq7	A	G	7: 118,510,048	I259T	unknown	Het
Cp	T	C	3: 19,974,966	S536P	probably damaging	Het
Cyp2d10	T	A	15: 82,404,246		probably null	Het
Dcst2	A	G	3: 89,366,300	I162V	probably benign	Het
Dennd4c	A	G	4: 86,802,991	E630G	probably damaging	Het
Dpt	A	T	1: 164,796,915	I62F	probably benign	Het
Ednrb	T	A	14: 103,843,008	I157F	probably damaging	Het
Ext1	A	T	15: 53,345,162	W68R	probably benign	Het
Fgf4	A	G	7: 144,862,786	K152E	probably benign	Het
G530012D18Rik	A	T	1: 85,577,143	T90S	unknown	Het
Galnt17	T	C	5: 130,964,111	T322A	possibly damaging	Het
Gcm1	A	T	9: 78,059,643	D48V	possibly damaging	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Gm49358	G	T	10: 86,825,207	R353L	probably damaging	Het
Golga4	A	G	9: 118,536,840	E320G	possibly damaging	Het
Herc3	T	C	6: 58,918,773	I1002T	probably damaging	Het
Hip1r	T	A	5: 123,973,782	V7E	possibly damaging	Het
Hipk1	G	A	3: 103,777,610	Q230*	probably null	Het
Igsf9b	C	T	9: 27,331,696	P726L	probably damaging	Het
Itgb6	T	C	2: 60,634,654	I345V	probably damaging	Het
Lhx4	G	T	1: 155,724,953	Q29K	probably benign	Het
Manba	A	G	3: 135,567,635	T777A	probably benign	Het
Mcm3ap	A	G	10: 76,501,311	D1360G	probably benign	Het
Meltf	T	A	16: 31,890,814		probably null	Het
Mmp14	T	G	14: 54,435,879	D81E	probably damaging	Het
Naalad2	T	C	9: 18,364,041		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Olfr1354	A	T	10: 78,917,505	I222L	possibly damaging	Het
Olfr881	T	A	9: 37,992,957	M150K	possibly damaging	Het
Pacs2	A	G	12: 113,061,692	D488G	possibly damaging	Het
Psg23	A	G	7: 18,607,139	S397P	probably benign	Het
Rfpl4	C	A	7: 5,110,660	R174L	probably damaging	Het
Runx3	T	A	4: 135,152,779	I3N	probably damaging	Het
Scn5a	A	T	9: 119,543,385	N214K	possibly damaging	Het
Slc27a1	T	C	8: 71,584,448	I412T	probably damaging	Het
Sptbn4	T	G	7: 27,416,785	T530P	probably benign	Het
Tex15	A	T	8: 33,570,826	R95*	probably null	Het
Tex15	T	C	8: 33,572,995	S818P	probably damaging	Het
Tmod1	A	T	4: 46,093,951	K221*	probably null	Het
Tpm3	G	A	3: 90,091,054	D272N	probably benign	Het
Trpm6	T	C	19: 18,853,791	V1340A	probably benign	Het
Ugt2b5	A	T	5: 87,125,272	C512S	probably benign	Het
Vmn2r82	A	T	10: 79,379,434	E417V	probably benign	Het
Wfdc11	T	C	2: 164,664,446	N60S	probably benign	Het
Zfp217	A	T	2: 170,114,152	S975R	probably benign	Het
Zfr	C	T	15: 12,146,223	Q287*	probably null	Het

Other mutations in Clca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00664:Clca1	APN	3	145027899	missense	probably benign	0.01
IGL00862:Clca1	APN	3	145024571	missense	possibly damaging	0.89
IGL00895:Clca1	APN	3	145024596	missense	probably damaging	1.00
IGL00969:Clca1	APN	3	145008958	missense	possibly damaging	0.80
IGL01398:Clca1	APN	3	145016751	missense	possibly damaging	0.81
IGL01447:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01455:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01457:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01458:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01462:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01473:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01488:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01490:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01632:Clca1	APN	3	145027441	missense	probably damaging	1.00
IGL01896:Clca1	APN	3	145015677	missense	possibly damaging	0.79
IGL02411:Clca1	APN	3	145028002	missense	possibly damaging	0.89
IGL03156:Clca1	APN	3	145013911	missense	probably damaging	1.00
R0472:Clca1	UTSW	3	145027345	missense	probably damaging	1.00
R0571:Clca1	UTSW	3	145007789	missense	probably damaging	1.00
R0585:Clca1	UTSW	3	145032625	missense	probably benign	0.16
R0586:Clca1	UTSW	3	145032589	missense	probably benign	0.45
R0791:Clca1	UTSW	3	145004854	missense	probably benign	0.01
R1187:Clca1	UTSW	3	145009743	missense	probably benign	0.30
R1713:Clca1	UTSW	3	145024546	missense	probably benign	0.00
R1739:Clca1	UTSW	3	145007778	missense	probably benign	0.00
R2079:Clca1	UTSW	3	145007773	missense	possibly damaging	0.80
R2129:Clca1	UTSW	3	145016765	missense	probably damaging	1.00
R2178:Clca1	UTSW	3	145006102	missense	probably damaging	1.00
R2234:Clca1	UTSW	3	145009068	missense	possibly damaging	0.93
R2235:Clca1	UTSW	3	145009068	missense	possibly damaging	0.93
R2240:Clca1	UTSW	3	145008985	missense	probably damaging	1.00
R3751:Clca1	UTSW	3	145018663	missense	probably benign	0.01
R3974:Clca1	UTSW	3	145032639	missense	probably damaging	1.00
R3975:Clca1	UTSW	3	145032639	missense	probably damaging	1.00
R4409:Clca1	UTSW	3	145006027	missense	probably damaging	1.00
R4586:Clca1	UTSW	3	145016858	missense	probably damaging	1.00
R4751:Clca1	UTSW	3	145004848	missense	possibly damaging	0.89
R4894:Clca1	UTSW	3	145013901	missense	probably damaging	0.99
R4909:Clca1	UTSW	3	145024563	missense	probably damaging	1.00
R4916:Clca1	UTSW	3	145015844	missense	probably benign	0.01
R4941:Clca1	UTSW	3	145015653	missense	probably damaging	1.00
R4942:Clca1	UTSW	3	145004763	missense	probably benign	0.02
R5044:Clca1	UTSW	3	145007928	splice site	probably null
R5451:Clca1	UTSW	3	145027986	missense	probably damaging	1.00
R5618:Clca1	UTSW	3	145004977	missense	probably benign	0.00
R5724:Clca1	UTSW	3	145009072	missense	probably benign	0.01
R5898:Clca1	UTSW	3	145016761	missense	possibly damaging	0.89
R6238:Clca1	UTSW	3	145008955	missense	probably benign	0.09
R6590:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6591:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6592:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6690:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6691:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6729:Clca1	UTSW	3	145005966	missense	probably damaging	1.00
R6805:Clca1	UTSW	3	145018667	missense	probably damaging	1.00
R7106:Clca1	UTSW	3	145027429	missense	probably damaging	0.98
R7121:Clca1	UTSW	3	145011806	missense	probably damaging	1.00
R7127:Clca1	UTSW	3	145006045	missense	probably damaging	1.00
R7444:Clca1	UTSW	3	145027432	missense	probably damaging	1.00
R7446:Clca1	UTSW	3	145027427	missense	possibly damaging	0.65
R7535:Clca1	UTSW	3	145018567	missense	probably damaging	0.99
R8437:Clca1	UTSW	3	145005061	missense	probably benign	0.00
R8474:Clca1	UTSW	3	145005031	missense	possibly damaging	0.77
R8766:Clca1	UTSW	3	145009178	splice site	probably benign
R8884:Clca1	UTSW	3	145013996	missense	probably benign	0.35
R9049:Clca1	UTSW	3	145027382	missense	probably benign	0.01
R9306:Clca1	UTSW	3	145024578	missense	probably damaging	1.00
R9623:Clca1	UTSW	3	145013937	missense	probably benign	0.03
X0020:Clca1	UTSW	3	145032660	missense	possibly damaging	0.89
Z1176:Clca1	UTSW	3	145013921	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCCATTTGAGATTCCCGCC -3'
(R):5'- TTGGGGTCTTGTTACCAGAC -3'

Sequencing Primer
(F):5'- ATTTGAGATTCCCGCCTTCTG -3'
(R):5'- CTTGTTACCAGACTTTAAAGTGGG -3'

Posted On

2019-06-26