Incidental Mutation 'R7212:Clca1'
ID 561129
Institutional Source Beutler Lab
Gene Symbol Clca1
Ensembl Gene ENSMUSG00000028255
Gene Name chloride channel accessory 1
Synonyms gob-5, gob5, Clca3
MMRRC Submission 045340-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7212 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 145003817-145032776 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 145005966 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 756 (I756S)
Ref Sequence ENSEMBL: ENSMUSP00000029919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029919]
AlphaFold Q9D7Z6
Predicted Effect probably damaging
Transcript: ENSMUST00000029919
AA Change: I756S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029919
Gene: ENSMUSG00000028255
AA Change: I756S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
VWA 305 478 5.05e-19 SMART
Blast:FN3 753 852 2e-28 BLAST
Meta Mutation Damage Score 0.4921 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same region on chromosome 1p31-p22 and share a high degree of homology in size, sequence, and predicted structure, but differ significantly in their tissue distributions. The encoded protein is expressed as a precursor protein that is processed into two cell-surface-associated subunits, although the site at which the precursor is cleaved has not been precisely determined. The encoded protein may be involved in mediating calcium-activated chloride conductance in the intestine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated mucin response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik C T 6: 83,161,672 A193V probably benign Het
4932438A13Rik C A 3: 37,048,009 N1363K Het
Aatf C T 11: 84,449,180 R435Q probably damaging Het
Abca13 A G 11: 9,298,854 H2867R probably benign Het
Abcd2 C T 15: 91,159,123 A621T possibly damaging Het
Actl11 T A 9: 107,928,657 S60T probably damaging Het
Adam28 T A 14: 68,637,397 N277I probably damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Arhgap27 C T 11: 103,360,755 R49Q probably damaging Het
Arhgap8 T G 15: 84,745,792 L108R probably null Het
Armc10 T C 5: 21,660,583 S209P probably damaging Het
Atp6v0a1 T C 11: 101,043,957 F617L probably benign Het
Bap1 T A 14: 31,251,623 N2K probably damaging Het
Cass4 T A 2: 172,427,186 L396* probably null Het
Ccdc40 A G 11: 119,264,444 Q1170R probably damaging Het
Cdhr5 C T 7: 141,272,659 R348H probably damaging Het
Cenpj A G 14: 56,552,652 S647P probably benign Het
Chordc1 T A 9: 18,295,351 probably null Het
Chordc1 T C 9: 18,301,012 S41P probably damaging Het
Ckm T C 7: 19,415,053 probably null Het
Clcn1 T C 6: 42,291,389 V165A possibly damaging Het
Clec4a4 T A 6: 122,991,745 probably null Het
Cog7 T C 7: 121,977,314 K130E probably damaging Het
Coq7 A G 7: 118,510,048 I259T unknown Het
Cp T C 3: 19,974,966 S536P probably damaging Het
Cyp2d10 T A 15: 82,404,246 probably null Het
Dcst2 A G 3: 89,366,300 I162V probably benign Het
Dennd4c A G 4: 86,802,991 E630G probably damaging Het
Dpt A T 1: 164,796,915 I62F probably benign Het
Ednrb T A 14: 103,843,008 I157F probably damaging Het
Ext1 A T 15: 53,345,162 W68R probably benign Het
Fgf4 A G 7: 144,862,786 K152E probably benign Het
G530012D18Rik A T 1: 85,577,143 T90S unknown Het
Galnt17 T C 5: 130,964,111 T322A possibly damaging Het
Gcm1 A T 9: 78,059,643 D48V possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm49358 G T 10: 86,825,207 R353L probably damaging Het
Golga4 A G 9: 118,536,840 E320G possibly damaging Het
Herc3 T C 6: 58,918,773 I1002T probably damaging Het
Hip1r T A 5: 123,973,782 V7E possibly damaging Het
Hipk1 G A 3: 103,777,610 Q230* probably null Het
Igsf9b C T 9: 27,331,696 P726L probably damaging Het
Itgb6 T C 2: 60,634,654 I345V probably damaging Het
Lhx4 G T 1: 155,724,953 Q29K probably benign Het
Manba A G 3: 135,567,635 T777A probably benign Het
Mcm3ap A G 10: 76,501,311 D1360G probably benign Het
Meltf T A 16: 31,890,814 probably null Het
Mmp14 T G 14: 54,435,879 D81E probably damaging Het
Naalad2 T C 9: 18,364,041 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1354 A T 10: 78,917,505 I222L possibly damaging Het
Olfr881 T A 9: 37,992,957 M150K possibly damaging Het
Pacs2 A G 12: 113,061,692 D488G possibly damaging Het
Psg23 A G 7: 18,607,139 S397P probably benign Het
Rfpl4 C A 7: 5,110,660 R174L probably damaging Het
Runx3 T A 4: 135,152,779 I3N probably damaging Het
Scn5a A T 9: 119,543,385 N214K possibly damaging Het
Slc27a1 T C 8: 71,584,448 I412T probably damaging Het
Sptbn4 T G 7: 27,416,785 T530P probably benign Het
Tex15 A T 8: 33,570,826 R95* probably null Het
Tex15 T C 8: 33,572,995 S818P probably damaging Het
Tmod1 A T 4: 46,093,951 K221* probably null Het
Tpm3 G A 3: 90,091,054 D272N probably benign Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Ugt2b5 A T 5: 87,125,272 C512S probably benign Het
Vmn2r82 A T 10: 79,379,434 E417V probably benign Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Zfp217 A T 2: 170,114,152 S975R probably benign Het
Zfr C T 15: 12,146,223 Q287* probably null Het
Other mutations in Clca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Clca1 APN 3 145027899 missense probably benign 0.01
IGL00862:Clca1 APN 3 145024571 missense possibly damaging 0.89
IGL00895:Clca1 APN 3 145024596 missense probably damaging 1.00
IGL00969:Clca1 APN 3 145008958 missense possibly damaging 0.80
IGL01398:Clca1 APN 3 145016751 missense possibly damaging 0.81
IGL01447:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01455:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01457:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01458:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01462:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01473:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01488:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01490:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01632:Clca1 APN 3 145027441 missense probably damaging 1.00
IGL01896:Clca1 APN 3 145015677 missense possibly damaging 0.79
IGL02411:Clca1 APN 3 145028002 missense possibly damaging 0.89
IGL03156:Clca1 APN 3 145013911 missense probably damaging 1.00
R0472:Clca1 UTSW 3 145027345 missense probably damaging 1.00
R0571:Clca1 UTSW 3 145007789 missense probably damaging 1.00
R0585:Clca1 UTSW 3 145032625 missense probably benign 0.16
R0586:Clca1 UTSW 3 145032589 missense probably benign 0.45
R0791:Clca1 UTSW 3 145004854 missense probably benign 0.01
R1187:Clca1 UTSW 3 145009743 missense probably benign 0.30
R1713:Clca1 UTSW 3 145024546 missense probably benign 0.00
R1739:Clca1 UTSW 3 145007778 missense probably benign 0.00
R2079:Clca1 UTSW 3 145007773 missense possibly damaging 0.80
R2129:Clca1 UTSW 3 145016765 missense probably damaging 1.00
R2178:Clca1 UTSW 3 145006102 missense probably damaging 1.00
R2234:Clca1 UTSW 3 145009068 missense possibly damaging 0.93
R2235:Clca1 UTSW 3 145009068 missense possibly damaging 0.93
R2240:Clca1 UTSW 3 145008985 missense probably damaging 1.00
R3751:Clca1 UTSW 3 145018663 missense probably benign 0.01
R3974:Clca1 UTSW 3 145032639 missense probably damaging 1.00
R3975:Clca1 UTSW 3 145032639 missense probably damaging 1.00
R4409:Clca1 UTSW 3 145006027 missense probably damaging 1.00
R4586:Clca1 UTSW 3 145016858 missense probably damaging 1.00
R4751:Clca1 UTSW 3 145004848 missense possibly damaging 0.89
R4894:Clca1 UTSW 3 145013901 missense probably damaging 0.99
R4909:Clca1 UTSW 3 145024563 missense probably damaging 1.00
R4916:Clca1 UTSW 3 145015844 missense probably benign 0.01
R4941:Clca1 UTSW 3 145015653 missense probably damaging 1.00
R4942:Clca1 UTSW 3 145004763 missense probably benign 0.02
R5044:Clca1 UTSW 3 145007928 splice site probably null
R5451:Clca1 UTSW 3 145027986 missense probably damaging 1.00
R5618:Clca1 UTSW 3 145004977 missense probably benign 0.00
R5724:Clca1 UTSW 3 145009072 missense probably benign 0.01
R5898:Clca1 UTSW 3 145016761 missense possibly damaging 0.89
R6238:Clca1 UTSW 3 145008955 missense probably benign 0.09
R6590:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6591:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6592:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6690:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6691:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6729:Clca1 UTSW 3 145005966 missense probably damaging 1.00
R6805:Clca1 UTSW 3 145018667 missense probably damaging 1.00
R7106:Clca1 UTSW 3 145027429 missense probably damaging 0.98
R7121:Clca1 UTSW 3 145011806 missense probably damaging 1.00
R7127:Clca1 UTSW 3 145006045 missense probably damaging 1.00
R7444:Clca1 UTSW 3 145027432 missense probably damaging 1.00
R7446:Clca1 UTSW 3 145027427 missense possibly damaging 0.65
R7535:Clca1 UTSW 3 145018567 missense probably damaging 0.99
R8437:Clca1 UTSW 3 145005061 missense probably benign 0.00
R8474:Clca1 UTSW 3 145005031 missense possibly damaging 0.77
R8766:Clca1 UTSW 3 145009178 splice site probably benign
R8884:Clca1 UTSW 3 145013996 missense probably benign 0.35
R9049:Clca1 UTSW 3 145027382 missense probably benign 0.01
R9306:Clca1 UTSW 3 145024578 missense probably damaging 1.00
R9623:Clca1 UTSW 3 145013937 missense probably benign 0.03
X0020:Clca1 UTSW 3 145032660 missense possibly damaging 0.89
Z1176:Clca1 UTSW 3 145013921 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCATTTGAGATTCCCGCC -3'
(R):5'- TTGGGGTCTTGTTACCAGAC -3'

Sequencing Primer
(F):5'- ATTTGAGATTCCCGCCTTCTG -3'
(R):5'- CTTGTTACCAGACTTTAAAGTGGG -3'
Posted On 2019-06-26