Incidental Mutation 'R7212:Tmod1'
ID561130
Institutional Source Beutler Lab
Gene Symbol Tmod1
Ensembl Gene ENSMUSG00000028328
Gene Nametropomodulin 1
Synonymserythrocyte tropomodulin, E-Tmod
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7212 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location46038935-46116032 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 46093951 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 221 (K221*)
Ref Sequence ENSEMBL: ENSMUSP00000103402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107773] [ENSMUST00000156200]
Predicted Effect probably null
Transcript: ENSMUST00000107773
AA Change: K221*
SMART Domains Protein: ENSMUSP00000103402
Gene: ENSMUSG00000028328
AA Change: K221*

DomainStartEndE-ValueType
Pfam:Tropomodulin 3 143 6.3e-64 PFAM
PDB:1IO0|A 160 344 1e-115 PDB
SCOP:d1a4ya_ 181 312 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156200
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tropomodulin family. The encoded protein is an actin-capping protein that regulates tropomyosin by binding to its N-terminus, inhibiting depolymerization and elongation of the pointed end of actin filaments and thereby influencing the structure of the erythrocyte membrane skeleton. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous inactivation of this locus results in aborted heart development and consequent embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik C T 6: 83,161,672 A193V probably benign Het
4932438A13Rik C A 3: 37,048,009 N1363K Het
Aatf C T 11: 84,449,180 R435Q probably damaging Het
Abca13 A G 11: 9,298,854 H2867R probably benign Het
Abcd2 C T 15: 91,159,123 A621T possibly damaging Het
Actl11 T A 9: 107,928,657 S60T probably damaging Het
Adam28 T A 14: 68,637,397 N277I probably damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Arhgap27 C T 11: 103,360,755 R49Q probably damaging Het
Arhgap8 T G 15: 84,745,792 L108R probably null Het
Armc10 T C 5: 21,660,583 S209P probably damaging Het
Atp6v0a1 T C 11: 101,043,957 F617L probably benign Het
Bap1 T A 14: 31,251,623 N2K probably damaging Het
Cass4 T A 2: 172,427,186 L396* probably null Het
Ccdc40 A G 11: 119,264,444 Q1170R probably damaging Het
Cdhr5 C T 7: 141,272,659 R348H probably damaging Het
Cenpj A G 14: 56,552,652 S647P probably benign Het
Chordc1 T A 9: 18,295,351 probably null Het
Chordc1 T C 9: 18,301,012 S41P probably damaging Het
Ckm T C 7: 19,415,053 probably null Het
Clca1 A C 3: 145,005,966 I756S probably damaging Het
Clcn1 T C 6: 42,291,389 V165A possibly damaging Het
Clec4a4 T A 6: 122,991,745 probably null Het
Cog7 T C 7: 121,977,314 K130E probably damaging Het
Coq7 A G 7: 118,510,048 I259T unknown Het
Cp T C 3: 19,974,966 S536P probably damaging Het
Cyp2d10 T A 15: 82,404,246 probably null Het
Dcst2 A G 3: 89,366,300 I162V probably benign Het
Dennd4c A G 4: 86,802,991 E630G probably damaging Het
Dpt A T 1: 164,796,915 I62F probably benign Het
Ednrb T A 14: 103,843,008 I157F probably damaging Het
Ext1 A T 15: 53,345,162 W68R probably benign Het
Fgf4 A G 7: 144,862,786 K152E probably benign Het
G530012D18Rik A T 1: 85,577,143 T90S unknown Het
Galnt17 T C 5: 130,964,111 T322A possibly damaging Het
Gcm1 A T 9: 78,059,643 D48V possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm49358 G T 10: 86,825,207 R353L probably damaging Het
Golga4 A G 9: 118,536,840 E320G possibly damaging Het
Herc3 T C 6: 58,918,773 I1002T probably damaging Het
Hip1r T A 5: 123,973,782 V7E possibly damaging Het
Hipk1 G A 3: 103,777,610 Q230* probably null Het
Igsf9b C T 9: 27,331,696 P726L probably damaging Het
Itgb6 T C 2: 60,634,654 I345V probably damaging Het
Lhx4 G T 1: 155,724,953 Q29K probably benign Het
Manba A G 3: 135,567,635 T777A probably benign Het
Mcm3ap A G 10: 76,501,311 D1360G probably benign Het
Meltf T A 16: 31,890,814 probably null Het
Mmp14 T G 14: 54,435,879 D81E probably damaging Het
Naalad2 T C 9: 18,364,041 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1354 A T 10: 78,917,505 I222L possibly damaging Het
Olfr881 T A 9: 37,992,957 M150K possibly damaging Het
Pacs2 A G 12: 113,061,692 D488G possibly damaging Het
Psg23 A G 7: 18,607,139 S397P probably benign Het
Rfpl4 C A 7: 5,110,660 R174L probably damaging Het
Runx3 T A 4: 135,152,779 I3N probably damaging Het
Scn5a A T 9: 119,543,385 N214K possibly damaging Het
Slc27a1 T C 8: 71,584,448 I412T probably damaging Het
Sptbn4 T G 7: 27,416,785 T530P probably benign Het
Tex15 A T 8: 33,570,826 R95* probably null Het
Tex15 T C 8: 33,572,995 S818P probably damaging Het
Tpm3 G A 3: 90,091,054 D272N probably benign Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Ugt2b5 A T 5: 87,125,272 C512S probably benign Het
Vmn2r82 A T 10: 79,379,434 E417V probably benign Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Zfp217 A T 2: 170,114,152 S975R probably benign Het
Zfr C T 15: 12,146,223 Q287* probably null Het
Other mutations in Tmod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03375:Tmod1 APN 4 46096999 missense probably damaging 1.00
R1445:Tmod1 UTSW 4 46090884 missense probably damaging 1.00
R1513:Tmod1 UTSW 4 46083549 missense possibly damaging 0.61
R1888:Tmod1 UTSW 4 46097069 synonymous silent
R1980:Tmod1 UTSW 4 46061043 missense probably damaging 1.00
R2914:Tmod1 UTSW 4 46092259 missense probably damaging 1.00
R3725:Tmod1 UTSW 4 46097026 missense probably benign 0.11
R3726:Tmod1 UTSW 4 46097026 missense probably benign 0.11
R3952:Tmod1 UTSW 4 46078315 missense probably damaging 0.98
R4854:Tmod1 UTSW 4 46090920 missense possibly damaging 0.80
R4989:Tmod1 UTSW 4 46090872 missense probably damaging 0.97
R6254:Tmod1 UTSW 4 46078469 splice site probably null
R7570:Tmod1 UTSW 4 46083632 missense probably benign 0.15
R7572:Tmod1 UTSW 4 46083593 missense possibly damaging 0.53
Z1176:Tmod1 UTSW 4 46092271 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCTCATGGCCCATTCAGAG -3'
(R):5'- GGGCTGTCTCATCTGTCTGTAC -3'

Sequencing Primer
(F):5'- TGGCCCATTCAGAGACTCAC -3'
(R):5'- CCTCCTGGCTCCTAGTGAG -3'
Posted On2019-06-26