Incidental Mutation 'R7212:Clcn1'
ID561136
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Namechloride channel, voltage-sensitive 1
SynonymsClc1, SMCC1, nmf355, NMF355, Clc-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7212 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42286685-42315756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42291389 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 165 (V165A)
Ref Sequence ENSEMBL: ENSMUSP00000031894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031894
AA Change: V165A

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: V165A

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: V135A

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164091
AA Change: V165A

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862
AA Change: V165A

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862
AA Change: V135A

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168660
AA Change: V132A

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862
AA Change: V132A

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862
AA Change: V135A

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862
AA Change: V135A

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik C T 6: 83,161,672 A193V probably benign Het
4932438A13Rik C A 3: 37,048,009 N1363K Het
Aatf C T 11: 84,449,180 R435Q probably damaging Het
Abca13 A G 11: 9,298,854 H2867R probably benign Het
Abcd2 C T 15: 91,159,123 A621T possibly damaging Het
Actl11 T A 9: 107,928,657 S60T probably damaging Het
Adam28 T A 14: 68,637,397 N277I probably damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Arhgap27 C T 11: 103,360,755 R49Q probably damaging Het
Arhgap8 T G 15: 84,745,792 L108R probably null Het
Armc10 T C 5: 21,660,583 S209P probably damaging Het
Atp6v0a1 T C 11: 101,043,957 F617L probably benign Het
Bap1 T A 14: 31,251,623 N2K probably damaging Het
Cass4 T A 2: 172,427,186 L396* probably null Het
Ccdc40 A G 11: 119,264,444 Q1170R probably damaging Het
Cdhr5 C T 7: 141,272,659 R348H probably damaging Het
Cenpj A G 14: 56,552,652 S647P probably benign Het
Chordc1 T A 9: 18,295,351 probably null Het
Chordc1 T C 9: 18,301,012 S41P probably damaging Het
Ckm T C 7: 19,415,053 probably null Het
Clca1 A C 3: 145,005,966 I756S probably damaging Het
Clec4a4 T A 6: 122,991,745 probably null Het
Cog7 T C 7: 121,977,314 K130E probably damaging Het
Coq7 A G 7: 118,510,048 I259T unknown Het
Cp T C 3: 19,974,966 S536P probably damaging Het
Cyp2d10 T A 15: 82,404,246 probably null Het
Dcst2 A G 3: 89,366,300 I162V probably benign Het
Dennd4c A G 4: 86,802,991 E630G probably damaging Het
Dpt A T 1: 164,796,915 I62F probably benign Het
Ednrb T A 14: 103,843,008 I157F probably damaging Het
Ext1 A T 15: 53,345,162 W68R probably benign Het
Fgf4 A G 7: 144,862,786 K152E probably benign Het
G530012D18Rik A T 1: 85,577,143 T90S unknown Het
Galnt17 T C 5: 130,964,111 T322A possibly damaging Het
Gcm1 A T 9: 78,059,643 D48V possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm49358 G T 10: 86,825,207 R353L probably damaging Het
Golga4 A G 9: 118,536,840 E320G possibly damaging Het
Herc3 T C 6: 58,918,773 I1002T probably damaging Het
Hip1r T A 5: 123,973,782 V7E possibly damaging Het
Hipk1 G A 3: 103,777,610 Q230* probably null Het
Igsf9b C T 9: 27,331,696 P726L probably damaging Het
Itgb6 T C 2: 60,634,654 I345V probably damaging Het
Lhx4 G T 1: 155,724,953 Q29K probably benign Het
Manba A G 3: 135,567,635 T777A probably benign Het
Mcm3ap A G 10: 76,501,311 D1360G probably benign Het
Meltf T A 16: 31,890,814 probably null Het
Mmp14 T G 14: 54,435,879 D81E probably damaging Het
Naalad2 T C 9: 18,364,041 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1354 A T 10: 78,917,505 I222L possibly damaging Het
Olfr881 T A 9: 37,992,957 M150K possibly damaging Het
Pacs2 A G 12: 113,061,692 D488G possibly damaging Het
Psg23 A G 7: 18,607,139 S397P probably benign Het
Rfpl4 C A 7: 5,110,660 R174L probably damaging Het
Runx3 T A 4: 135,152,779 I3N probably damaging Het
Scn5a A T 9: 119,543,385 N214K possibly damaging Het
Slc27a1 T C 8: 71,584,448 I412T probably damaging Het
Sptbn4 T G 7: 27,416,785 T530P probably benign Het
Tex15 A T 8: 33,570,826 R95* probably null Het
Tex15 T C 8: 33,572,995 S818P probably damaging Het
Tmod1 A T 4: 46,093,951 K221* probably null Het
Tpm3 G A 3: 90,091,054 D272N probably benign Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Ugt2b5 A T 5: 87,125,272 C512S probably benign Het
Vmn2r82 A T 10: 79,379,434 E417V probably benign Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Zfp217 A T 2: 170,114,152 S975R probably benign Het
Zfr C T 15: 12,146,223 Q287* probably null Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42291703 missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42310672 splice site probably benign
IGL02055:Clcn1 APN 6 42307555 missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42307073 splice site probably benign
IGL02649:Clcn1 APN 6 42298829 missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42286780 unclassified probably null
IGL03148:Clcn1 APN 6 42299991 critical splice donor site probably null
IGL03190:Clcn1 APN 6 42290103 missense probably benign 0.02
IGL03327:Clcn1 APN 6 42311219 missense probably benign 0.00
IGL03346:Clcn1 APN 6 42311219 missense probably benign 0.00
maimed UTSW 6 42298820 missense probably damaging 1.00
R0167:Clcn1 UTSW 6 42286836 missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42310140 missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42310581 missense probably benign
R0573:Clcn1 UTSW 6 42313045 splice site probably null
R0615:Clcn1 UTSW 6 42305575 missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42313141 missense probably benign 0.00
R1562:Clcn1 UTSW 6 42300235 missense probably benign 0.29
R1566:Clcn1 UTSW 6 42291440 missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42313098 missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42294145 missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42298926 critical splice donor site probably null
R1861:Clcn1 UTSW 6 42313991 missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42291625 missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42313112 missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42298850 missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42290178 missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42292995 missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42309968 missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42290197 splice site probably null
R4836:Clcn1 UTSW 6 42309964 missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42310988 nonsense probably null
R5085:Clcn1 UTSW 6 42313880 missense probably benign 0.41
R5528:Clcn1 UTSW 6 42300341 missense probably benign 0.01
R5628:Clcn1 UTSW 6 42298889 missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42307265 missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42292966 missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42300274 nonsense probably null
R6175:Clcn1 UTSW 6 42314162 missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42307590 missense possibly damaging 0.84
R6394:Clcn1 UTSW 6 42313238 missense possibly damaging 0.82
R7012:Clcn1 UTSW 6 42290608 missense probably benign 0.01
R7020:Clcn1 UTSW 6 42298820 missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42307543 missense probably damaging 1.00
R7225:Clcn1 UTSW 6 42293462 missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42298838 missense probably damaging 1.00
R7636:Clcn1 UTSW 6 42291334 nonsense probably null
R7663:Clcn1 UTSW 6 42310063 missense possibly damaging 0.79
Z1088:Clcn1 UTSW 6 42300360 missense probably benign 0.40
Z1088:Clcn1 UTSW 6 42307256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAGCAAGTTGGCATACTATC -3'
(R):5'- ATCTCAGGGATTCCAGAGCC -3'

Sequencing Primer
(F):5'- GCAAGTTGGCATACTATCCTATCTGG -3'
(R):5'- TCTCAGGGATTCCAGAGCCTAAAAG -3'
Posted On2019-06-26