Mutagenetix > Incidental Mutation

Incidental Mutation 'R7212:Sptbn4'

561142

Institutional Source

Beutler Lab

Gene Symbol

Sptbn4

Ensembl Gene

ENSMUSG00000011751

Gene Name

spectrin beta, non-erythrocytic 4

Synonyms

ROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4

MMRRC Submission

045340-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.382) question?

Stock #

R7212 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27356383-27447686 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 27416785 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 530 (T530P)

Ref Sequence

ENSEMBL: ENSMUSP00000011895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000172269]

AlphaFold

E9PX29

Predicted Effect

probably benign
Transcript: ENSMUST00000011895
AA Change: T530P

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: T530P

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.4e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	642	7.62e-19	SMART
SPEC	648	766	1.31e-8	SMART
SPEC	772	874	2.94e-11	SMART
SPEC	880	980	1.49e-21	SMART
SPEC	986	1081	1.65e0	SMART
SPEC	1087	1192	2.82e-13	SMART
SPEC	1198	1298	6.59e-14	SMART
SPEC	1304	1403	4.08e-19	SMART
SPEC	1409	1508	5.92e-7	SMART
SPEC	1514	1614	2.45e-22	SMART
SPEC	1620	1720	1.45e-24	SMART
SPEC	1726	1827	1.86e-22	SMART
SPEC	1833	1935	9.54e-11	SMART
SPEC	1941	2041	1.35e-19	SMART
SPEC	2047	2297	1.06e-8	SMART
low complexity region	2358	2412	N/A	INTRINSIC
PH	2416	2526	1.54e-14	SMART
low complexity region	2549	2560	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172269
AA Change: T530P

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: T530P

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.9e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	637	3.45e-17	SMART
SPEC	643	761	1.31e-8	SMART
SPEC	767	869	2.94e-11	SMART
SPEC	875	975	1.49e-21	SMART
SPEC	981	1076	1.65e0	SMART
SPEC	1082	1187	2.82e-13	SMART
SPEC	1193	1293	6.59e-14	SMART
SPEC	1299	1398	4.08e-19	SMART
SPEC	1404	1503	5.92e-7	SMART
SPEC	1509	1609	2.45e-22	SMART
SPEC	1615	1715	1.45e-24	SMART
SPEC	1721	1822	1.86e-22	SMART
SPEC	1828	1930	9.54e-11	SMART
SPEC	1936	2036	1.35e-19	SMART
SPEC	2042	2292	1.06e-8	SMART
low complexity region	2352	2406	N/A	INTRINSIC
PH	2410	2520	1.54e-14	SMART
low complexity region	2543	2554	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	C	T	6: 83,161,672	A193V	probably benign	Het
4932438A13Rik	C	A	3: 37,048,009	N1363K		Het
Aatf	C	T	11: 84,449,180	R435Q	probably damaging	Het
Abca13	A	G	11: 9,298,854	H2867R	probably benign	Het
Abcd2	C	T	15: 91,159,123	A621T	possibly damaging	Het
Actl11	T	A	9: 107,928,657	S60T	probably damaging	Het
Adam28	T	A	14: 68,637,397	N277I	probably damaging	Het
Adamts13	T	A	2: 27,006,314	C1240S	probably damaging	Het
Arhgap27	C	T	11: 103,360,755	R49Q	probably damaging	Het
Arhgap8	T	G	15: 84,745,792	L108R	probably null	Het
Armc10	T	C	5: 21,660,583	S209P	probably damaging	Het
Atp6v0a1	T	C	11: 101,043,957	F617L	probably benign	Het
Bap1	T	A	14: 31,251,623	N2K	probably damaging	Het
Cass4	T	A	2: 172,427,186	L396*	probably null	Het
Ccdc40	A	G	11: 119,264,444	Q1170R	probably damaging	Het
Cdhr5	C	T	7: 141,272,659	R348H	probably damaging	Het
Cenpj	A	G	14: 56,552,652	S647P	probably benign	Het
Chordc1	T	A	9: 18,295,351		probably null	Het
Chordc1	T	C	9: 18,301,012	S41P	probably damaging	Het
Ckm	T	C	7: 19,415,053		probably null	Het
Clca1	A	C	3: 145,005,966	I756S	probably damaging	Het
Clcn1	T	C	6: 42,291,389	V165A	possibly damaging	Het
Clec4a4	T	A	6: 122,991,745		probably null	Het
Cog7	T	C	7: 121,977,314	K130E	probably damaging	Het
Coq7	A	G	7: 118,510,048	I259T	unknown	Het
Cp	T	C	3: 19,974,966	S536P	probably damaging	Het
Cyp2d10	T	A	15: 82,404,246		probably null	Het
Dcst2	A	G	3: 89,366,300	I162V	probably benign	Het
Dennd4c	A	G	4: 86,802,991	E630G	probably damaging	Het
Dpt	A	T	1: 164,796,915	I62F	probably benign	Het
Ednrb	T	A	14: 103,843,008	I157F	probably damaging	Het
Ext1	A	T	15: 53,345,162	W68R	probably benign	Het
Fgf4	A	G	7: 144,862,786	K152E	probably benign	Het
G530012D18Rik	A	T	1: 85,577,143	T90S	unknown	Het
Galnt17	T	C	5: 130,964,111	T322A	possibly damaging	Het
Gcm1	A	T	9: 78,059,643	D48V	possibly damaging	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Gm49358	G	T	10: 86,825,207	R353L	probably damaging	Het
Golga4	A	G	9: 118,536,840	E320G	possibly damaging	Het
Herc3	T	C	6: 58,918,773	I1002T	probably damaging	Het
Hip1r	T	A	5: 123,973,782	V7E	possibly damaging	Het
Hipk1	G	A	3: 103,777,610	Q230*	probably null	Het
Igsf9b	C	T	9: 27,331,696	P726L	probably damaging	Het
Itgb6	T	C	2: 60,634,654	I345V	probably damaging	Het
Lhx4	G	T	1: 155,724,953	Q29K	probably benign	Het
Manba	A	G	3: 135,567,635	T777A	probably benign	Het
Mcm3ap	A	G	10: 76,501,311	D1360G	probably benign	Het
Meltf	T	A	16: 31,890,814		probably null	Het
Mmp14	T	G	14: 54,435,879	D81E	probably damaging	Het
Naalad2	T	C	9: 18,364,041		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Olfr1354	A	T	10: 78,917,505	I222L	possibly damaging	Het
Olfr881	T	A	9: 37,992,957	M150K	possibly damaging	Het
Pacs2	A	G	12: 113,061,692	D488G	possibly damaging	Het
Psg23	A	G	7: 18,607,139	S397P	probably benign	Het
Rfpl4	C	A	7: 5,110,660	R174L	probably damaging	Het
Runx3	T	A	4: 135,152,779	I3N	probably damaging	Het
Scn5a	A	T	9: 119,543,385	N214K	possibly damaging	Het
Slc27a1	T	C	8: 71,584,448	I412T	probably damaging	Het
Tex15	A	T	8: 33,570,826	R95*	probably null	Het
Tex15	T	C	8: 33,572,995	S818P	probably damaging	Het
Tmod1	A	T	4: 46,093,951	K221*	probably null	Het
Tpm3	G	A	3: 90,091,054	D272N	probably benign	Het
Trpm6	T	C	19: 18,853,791	V1340A	probably benign	Het
Ugt2b5	A	T	5: 87,125,272	C512S	probably benign	Het
Vmn2r82	A	T	10: 79,379,434	E417V	probably benign	Het
Wfdc11	T	C	2: 164,664,446	N60S	probably benign	Het
Zfp217	A	T	2: 170,114,152	S975R	probably benign	Het
Zfr	C	T	15: 12,146,223	Q287*	probably null	Het

Other mutations in Sptbn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sptbn4	APN	7	27369434	missense	probably damaging	1.00
IGL00468:Sptbn4	APN	7	27417965	missense	probably damaging	1.00
IGL01396:Sptbn4	APN	7	27414771	missense	probably benign	0.06
IGL01700:Sptbn4	APN	7	27404268	missense	probably damaging	1.00
IGL01878:Sptbn4	APN	7	27364146	missense	probably damaging	0.99
IGL02066:Sptbn4	APN	7	27364515	missense	possibly damaging	0.68
IGL02116:Sptbn4	APN	7	27364357	missense	probably benign
IGL02226:Sptbn4	APN	7	27365707	missense	probably damaging	1.00
IGL02333:Sptbn4	APN	7	27364299	missense	probably damaging	1.00
IGL02337:Sptbn4	APN	7	27428247	missense	probably benign	0.03
IGL02451:Sptbn4	APN	7	27365589	missense	probably null	0.15
IGL02487:Sptbn4	APN	7	27419097	missense	probably damaging	1.00
IGL02530:Sptbn4	APN	7	27391551	missense	probably damaging	1.00
IGL02724:Sptbn4	APN	7	27367679	missense	probably damaging	1.00
IGL02850:Sptbn4	APN	7	27426833	missense	possibly damaging	0.95
IGL02851:Sptbn4	APN	7	27426833	missense	possibly damaging	0.95
IGL02869:Sptbn4	APN	7	27394148	splice site	probably benign
IGL02961:Sptbn4	APN	7	27397967	missense	probably damaging	1.00
ANU22:Sptbn4	UTSW	7	27357387	nonsense	probably null
R0194:Sptbn4	UTSW	7	27404911	missense	probably benign	0.00
R0328:Sptbn4	UTSW	7	27364170	missense	probably damaging	1.00
R0379:Sptbn4	UTSW	7	27359736	splice site	probably benign
R0510:Sptbn4	UTSW	7	27361566	critical splice donor site	probably null
R0550:Sptbn4	UTSW	7	27364378	missense	probably benign	0.16
R0557:Sptbn4	UTSW	7	27408328	nonsense	probably null
R1336:Sptbn4	UTSW	7	27417963	missense	probably damaging	1.00
R1494:Sptbn4	UTSW	7	27434294	missense	probably damaging	1.00
R1630:Sptbn4	UTSW	7	27418739	missense	probably benign	0.09
R1803:Sptbn4	UTSW	7	27418583	missense	probably damaging	1.00
R1834:Sptbn4	UTSW	7	27366646	missense	probably null	0.96
R1906:Sptbn4	UTSW	7	27391431	critical splice donor site	probably null
R1924:Sptbn4	UTSW	7	27407138	missense	probably damaging	1.00
R1951:Sptbn4	UTSW	7	27366443	missense	possibly damaging	0.64
R1989:Sptbn4	UTSW	7	27367702	missense	probably damaging	1.00
R1990:Sptbn4	UTSW	7	27423810	missense	probably benign	0.19
R2005:Sptbn4	UTSW	7	27366419	nonsense	probably null
R2083:Sptbn4	UTSW	7	27428256	missense	probably benign	0.29
R2176:Sptbn4	UTSW	7	27364162	missense	probably benign	0.21
R2211:Sptbn4	UTSW	7	27367609	missense	probably damaging	1.00
R2262:Sptbn4	UTSW	7	27434357	missense	probably damaging	1.00
R2263:Sptbn4	UTSW	7	27434357	missense	probably damaging	1.00
R2374:Sptbn4	UTSW	7	27360092	missense	probably damaging	0.99
R2407:Sptbn4	UTSW	7	27418098	nonsense	probably null
R4115:Sptbn4	UTSW	7	27391570	missense	probably damaging	1.00
R4116:Sptbn4	UTSW	7	27391570	missense	probably damaging	1.00
R4392:Sptbn4	UTSW	7	27418471	missense	probably damaging	0.97
R4426:Sptbn4	UTSW	7	27423798	missense	probably damaging	1.00
R4535:Sptbn4	UTSW	7	27367702	missense	probably damaging	1.00
R4684:Sptbn4	UTSW	7	27364419	missense	probably damaging	0.96
R4684:Sptbn4	UTSW	7	27366735	missense	possibly damaging	0.60
R4707:Sptbn4	UTSW	7	27417006	missense	probably benign	0.12
R4876:Sptbn4	UTSW	7	27372152	missense	probably damaging	1.00
R5091:Sptbn4	UTSW	7	27369391	missense	probably damaging	1.00
R5371:Sptbn4	UTSW	7	27359741	critical splice donor site	probably null
R5790:Sptbn4	UTSW	7	27366428	missense	probably damaging	0.99
R5857:Sptbn4	UTSW	7	27418713	missense	possibly damaging	0.89
R5908:Sptbn4	UTSW	7	27404253	missense	probably benign	0.00
R5980:Sptbn4	UTSW	7	27372171	missense	probably damaging	1.00
R6005:Sptbn4	UTSW	7	27418599	missense	probably damaging	1.00
R6013:Sptbn4	UTSW	7	27364479	missense	probably damaging	0.99
R6037:Sptbn4	UTSW	7	27364170	missense	probably damaging	0.97
R6037:Sptbn4	UTSW	7	27364170	missense	probably damaging	0.97
R6129:Sptbn4	UTSW	7	27360088	missense	probably damaging	0.98
R6146:Sptbn4	UTSW	7	27364587	nonsense	probably null
R6762:Sptbn4	UTSW	7	27394208	missense	probably damaging	1.00
R6897:Sptbn4	UTSW	7	27371950	missense	possibly damaging	0.96
R7178:Sptbn4	UTSW	7	27418056	missense	probably damaging	1.00
R7465:Sptbn4	UTSW	7	27366689	missense	probably benign	0.00
R7471:Sptbn4	UTSW	7	27409014	missense	possibly damaging	0.64
R7510:Sptbn4	UTSW	7	27428268	missense	probably benign	0.13
R7527:Sptbn4	UTSW	7	27375590	missense	possibly damaging	0.94
R7528:Sptbn4	UTSW	7	27442535	missense	probably benign	0.00
R7572:Sptbn4	UTSW	7	27372272	missense	probably damaging	0.99
R7649:Sptbn4	UTSW	7	27361577	missense	possibly damaging	0.80
R7714:Sptbn4	UTSW	7	27364336	missense	probably benign	0.02
R7780:Sptbn4	UTSW	7	27361634	missense	possibly damaging	0.70
R7854:Sptbn4	UTSW	7	27362410	missense	probably benign
R8002:Sptbn4	UTSW	7	27417992	missense	possibly damaging	0.91
R8058:Sptbn4	UTSW	7	27364269	missense	possibly damaging	0.92
R8181:Sptbn4	UTSW	7	27375383	missense	possibly damaging	0.79
R8195:Sptbn4	UTSW	7	27408889	nonsense	probably null
R8353:Sptbn4	UTSW	7	27404238	missense	probably damaging	1.00
R8392:Sptbn4	UTSW	7	27372296	missense	probably damaging	1.00
R8453:Sptbn4	UTSW	7	27404238	missense	probably damaging	1.00
R8815:Sptbn4	UTSW	7	27407232	nonsense	probably null
R8818:Sptbn4	UTSW	7	27364167	missense	possibly damaging	0.71
R9171:Sptbn4	UTSW	7	27442419	missense	possibly damaging	0.95
R9259:Sptbn4	UTSW	7	27367699	missense	possibly damaging	0.74
R9477:Sptbn4	UTSW	7	27433199	missense	possibly damaging	0.79
R9564:Sptbn4	UTSW	7	27418079	missense	probably damaging	0.98
R9572:Sptbn4	UTSW	7	27366670	missense	probably benign	0.16
R9623:Sptbn4	UTSW	7	27408382	missense	probably damaging	1.00
R9715:Sptbn4	UTSW	7	27391575	missense	probably damaging	1.00
R9782:Sptbn4	UTSW	7	27408568	missense	probably benign	0.02
R9790:Sptbn4	UTSW	7	27372237	missense	probably damaging	0.99
R9791:Sptbn4	UTSW	7	27372237	missense	probably damaging	0.99
R9798:Sptbn4	UTSW	7	27357292	makesense	probably null
X0020:Sptbn4	UTSW	7	27402734	critical splice donor site	probably null
X0066:Sptbn4	UTSW	7	27357311	unclassified	probably benign
Z1176:Sptbn4	UTSW	7	27360025	missense	probably damaging	0.99
Z1177:Sptbn4	UTSW	7	27404582	missense	probably damaging	1.00
Z1177:Sptbn4	UTSW	7	27409102	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- CTCCGTGTCAACCCAGAATC -3'
(R):5'- AAGCATCAGGAGGACTTGCTG -3'

Sequencing Primer
(F):5'- GTGTCAACCCAGAATCTGCATC -3'
(R):5'- AACTTCGGATATGAGCTGCC -3'

Posted On

2019-06-26