Incidental Mutation 'R7212:Igsf9b'
ID 561152
Institutional Source Beutler Lab
Gene Symbol Igsf9b
Ensembl Gene ENSMUSG00000034275
Gene Name immunoglobulin superfamily, member 9B
Synonyms AI414108, LOC235086
MMRRC Submission 045340-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R7212 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 27210500-27268842 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27242992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 726 (P726L)
Ref Sequence ENSEMBL: ENSMUSP00000149356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]
AlphaFold E9PZ19
Predicted Effect probably benign
Transcript: ENSMUST00000115247
SMART Domains Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133213
AA Change: P722L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: P722L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 835 843 N/A INTRINSIC
low complexity region 971 982 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1148 1161 N/A INTRINSIC
low complexity region 1172 1190 N/A INTRINSIC
low complexity region 1246 1273 N/A INTRINSIC
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1313 1326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214357
AA Change: P726L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik C T 6: 83,138,654 (GRCm39) A193V probably benign Het
Aatf C T 11: 84,340,006 (GRCm39) R435Q probably damaging Het
Abca13 A G 11: 9,248,854 (GRCm39) H2867R probably benign Het
Abcd2 C T 15: 91,043,326 (GRCm39) A621T possibly damaging Het
Actl11 T A 9: 107,805,856 (GRCm39) S60T probably damaging Het
Adam28 T A 14: 68,874,846 (GRCm39) N277I probably damaging Het
Adamts13 T A 2: 26,896,326 (GRCm39) C1240S probably damaging Het
Arhgap27 C T 11: 103,251,581 (GRCm39) R49Q probably damaging Het
Armc10 T C 5: 21,865,581 (GRCm39) S209P probably damaging Het
Atp6v0a1 T C 11: 100,934,783 (GRCm39) F617L probably benign Het
Bap1 T A 14: 30,973,580 (GRCm39) N2K probably damaging Het
Bltp1 C A 3: 37,102,158 (GRCm39) N1363K Het
Cass4 T A 2: 172,269,106 (GRCm39) L396* probably null Het
Ccdc40 A G 11: 119,155,270 (GRCm39) Q1170R probably damaging Het
Cdhr5 C T 7: 140,852,572 (GRCm39) R348H probably damaging Het
Cenpj A G 14: 56,790,109 (GRCm39) S647P probably benign Het
Chordc1 T C 9: 18,212,308 (GRCm39) S41P probably damaging Het
Chordc1 T A 9: 18,206,647 (GRCm39) probably null Het
Ckm T C 7: 19,148,978 (GRCm39) probably null Het
Clca3a1 A C 3: 144,711,727 (GRCm39) I756S probably damaging Het
Clcn1 T C 6: 42,268,323 (GRCm39) V165A possibly damaging Het
Clec4a4 T A 6: 122,968,704 (GRCm39) probably null Het
Cog7 T C 7: 121,576,537 (GRCm39) K130E probably damaging Het
Coq7 A G 7: 118,109,271 (GRCm39) I259T unknown Het
Cp T C 3: 20,029,130 (GRCm39) S536P probably damaging Het
Cyp2d10 T A 15: 82,288,447 (GRCm39) probably null Het
Dcst2 A G 3: 89,273,607 (GRCm39) I162V probably benign Het
Dennd4c A G 4: 86,721,228 (GRCm39) E630G probably damaging Het
Dpt A T 1: 164,624,484 (GRCm39) I62F probably benign Het
Ednrb T A 14: 104,080,444 (GRCm39) I157F probably damaging Het
Ext1 A T 15: 53,208,558 (GRCm39) W68R probably benign Het
Fgf4 A G 7: 144,416,523 (GRCm39) K152E probably benign Het
G530012D18Rik A T 1: 85,504,864 (GRCm39) T90S unknown Het
Galnt17 T C 5: 130,992,949 (GRCm39) T322A possibly damaging Het
Gcm1 A T 9: 77,966,925 (GRCm39) D48V possibly damaging Het
Gdi1 G A X: 73,350,461 (GRCm39) R55H probably benign Het
Gm49358 G T 10: 86,661,071 (GRCm39) R353L probably damaging Het
Golga4 A G 9: 118,365,908 (GRCm39) E320G possibly damaging Het
Herc3 T C 6: 58,895,758 (GRCm39) I1002T probably damaging Het
Hip1r T A 5: 124,111,845 (GRCm39) V7E possibly damaging Het
Hipk1 G A 3: 103,684,926 (GRCm39) Q230* probably null Het
Itgb6 T C 2: 60,464,998 (GRCm39) I345V probably damaging Het
Lhx4 G T 1: 155,600,699 (GRCm39) Q29K probably benign Het
Manba A G 3: 135,273,396 (GRCm39) T777A probably benign Het
Mcm3ap A G 10: 76,337,145 (GRCm39) D1360G probably benign Het
Meltf T A 16: 31,709,632 (GRCm39) probably null Het
Mmp14 T G 14: 54,673,336 (GRCm39) D81E probably damaging Het
Naalad2 T C 9: 18,275,337 (GRCm39) probably null Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Or7a38 A T 10: 78,753,339 (GRCm39) I222L possibly damaging Het
Or8b35 T A 9: 37,904,253 (GRCm39) M150K possibly damaging Het
Pacs2 A G 12: 113,025,312 (GRCm39) D488G possibly damaging Het
Prr5 T G 15: 84,629,993 (GRCm39) L108R probably null Het
Psg23 A G 7: 18,341,064 (GRCm39) S397P probably benign Het
Rfpl4 C A 7: 5,113,659 (GRCm39) R174L probably damaging Het
Runx3 T A 4: 134,880,090 (GRCm39) I3N probably damaging Het
Scn5a A T 9: 119,372,451 (GRCm39) N214K possibly damaging Het
Slc27a1 T C 8: 72,037,092 (GRCm39) I412T probably damaging Het
Sptbn4 T G 7: 27,116,210 (GRCm39) T530P probably benign Het
Tex15 A T 8: 34,060,854 (GRCm39) R95* probably null Het
Tex15 T C 8: 34,063,023 (GRCm39) S818P probably damaging Het
Tmod1 A T 4: 46,093,951 (GRCm39) K221* probably null Het
Tpm3 G A 3: 89,998,361 (GRCm39) D272N probably benign Het
Trpm6 T C 19: 18,831,155 (GRCm39) V1340A probably benign Het
Ugt2b5 A T 5: 87,273,131 (GRCm39) C512S probably benign Het
Vmn2r82 A T 10: 79,215,268 (GRCm39) E417V probably benign Het
Wfdc11 T C 2: 164,506,366 (GRCm39) N60S probably benign Het
Zfp217 A T 2: 169,956,072 (GRCm39) S975R probably benign Het
Zfr C T 15: 12,146,309 (GRCm39) Q287* probably null Het
Other mutations in Igsf9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Igsf9b APN 9 27,230,951 (GRCm39) missense probably damaging 1.00
IGL01013:Igsf9b APN 9 27,245,600 (GRCm39) missense probably damaging 1.00
IGL01960:Igsf9b APN 9 27,239,902 (GRCm39) missense possibly damaging 0.93
IGL02398:Igsf9b APN 9 27,244,426 (GRCm39) missense possibly damaging 0.54
IGL03007:Igsf9b APN 9 27,244,378 (GRCm39) missense probably damaging 0.98
G1Funyon:Igsf9b UTSW 9 27,246,035 (GRCm39) utr 3 prime probably benign
IGL03014:Igsf9b UTSW 9 27,233,932 (GRCm39) missense probably benign 0.00
R0127:Igsf9b UTSW 9 27,245,681 (GRCm39) missense possibly damaging 0.65
R0376:Igsf9b UTSW 9 27,245,878 (GRCm39) missense probably benign 0.01
R0520:Igsf9b UTSW 9 27,234,546 (GRCm39) missense probably benign 0.00
R0534:Igsf9b UTSW 9 27,244,358 (GRCm39) splice site probably null
R0613:Igsf9b UTSW 9 27,238,216 (GRCm39) missense probably damaging 1.00
R0718:Igsf9b UTSW 9 27,234,657 (GRCm39) critical splice donor site probably null
R0828:Igsf9b UTSW 9 27,230,901 (GRCm39) nonsense probably null
R0879:Igsf9b UTSW 9 27,245,038 (GRCm39) missense probably damaging 1.00
R0882:Igsf9b UTSW 9 27,230,612 (GRCm39) missense probably damaging 0.98
R0987:Igsf9b UTSW 9 27,243,849 (GRCm39) splice site probably null
R1162:Igsf9b UTSW 9 27,238,185 (GRCm39) missense probably benign
R1758:Igsf9b UTSW 9 27,245,548 (GRCm39) missense possibly damaging 0.50
R1760:Igsf9b UTSW 9 27,229,123 (GRCm39) missense possibly damaging 0.82
R1819:Igsf9b UTSW 9 27,222,889 (GRCm39) missense probably damaging 0.98
R1823:Igsf9b UTSW 9 27,243,028 (GRCm39) missense probably damaging 0.96
R1982:Igsf9b UTSW 9 27,233,535 (GRCm39) missense possibly damaging 0.82
R2150:Igsf9b UTSW 9 27,245,633 (GRCm39) missense probably damaging 1.00
R2228:Igsf9b UTSW 9 27,244,792 (GRCm39) missense probably damaging 1.00
R2229:Igsf9b UTSW 9 27,244,792 (GRCm39) missense probably damaging 1.00
R2250:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R2872:Igsf9b UTSW 9 27,233,519 (GRCm39) missense probably benign 0.11
R2872:Igsf9b UTSW 9 27,233,519 (GRCm39) missense probably benign 0.11
R3415:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R3416:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R3417:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R3427:Igsf9b UTSW 9 27,245,873 (GRCm39) missense probably damaging 0.99
R4356:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R4357:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R4358:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R4359:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R4379:Igsf9b UTSW 9 27,220,774 (GRCm39) missense possibly damaging 0.95
R4416:Igsf9b UTSW 9 27,234,213 (GRCm39) missense probably damaging 1.00
R4445:Igsf9b UTSW 9 27,245,548 (GRCm39) missense probably benign 0.13
R4446:Igsf9b UTSW 9 27,245,548 (GRCm39) missense probably benign 0.13
R4787:Igsf9b UTSW 9 27,228,752 (GRCm39) missense probably benign 0.26
R4887:Igsf9b UTSW 9 27,233,946 (GRCm39) missense probably benign 0.45
R5085:Igsf9b UTSW 9 27,228,733 (GRCm39) missense probably benign 0.03
R5360:Igsf9b UTSW 9 27,222,968 (GRCm39) missense probably damaging 0.98
R5417:Igsf9b UTSW 9 27,245,572 (GRCm39) small insertion probably benign
R5686:Igsf9b UTSW 9 27,235,475 (GRCm39) missense probably damaging 0.99
R5738:Igsf9b UTSW 9 27,239,826 (GRCm39) missense probably damaging 0.98
R5869:Igsf9b UTSW 9 27,234,531 (GRCm39) missense probably benign 0.44
R6304:Igsf9b UTSW 9 27,253,871 (GRCm39) missense probably benign 0.19
R6359:Igsf9b UTSW 9 27,220,895 (GRCm39) missense probably benign 0.25
R6367:Igsf9b UTSW 9 27,220,821 (GRCm39) nonsense probably null
R6556:Igsf9b UTSW 9 27,240,851 (GRCm39) missense probably damaging 1.00
R7058:Igsf9b UTSW 9 27,234,150 (GRCm39) missense probably damaging 0.99
R7165:Igsf9b UTSW 9 27,245,536 (GRCm39) missense probably benign
R7180:Igsf9b UTSW 9 27,233,964 (GRCm39) missense possibly damaging 0.95
R7461:Igsf9b UTSW 9 27,245,418 (GRCm39) missense probably benign 0.10
R7605:Igsf9b UTSW 9 27,234,608 (GRCm39) missense probably damaging 0.98
R7609:Igsf9b UTSW 9 27,257,186 (GRCm39) missense probably benign
R7613:Igsf9b UTSW 9 27,245,418 (GRCm39) missense probably benign 0.10
R8072:Igsf9b UTSW 9 27,228,660 (GRCm39) missense possibly damaging 0.94
R8163:Igsf9b UTSW 9 27,233,907 (GRCm39) splice site probably null
R8301:Igsf9b UTSW 9 27,246,035 (GRCm39) utr 3 prime probably benign
R8546:Igsf9b UTSW 9 27,244,426 (GRCm39) missense possibly damaging 0.54
R8553:Igsf9b UTSW 9 27,244,739 (GRCm39) missense probably damaging 0.96
R9438:Igsf9b UTSW 9 27,243,839 (GRCm39) missense probably benign 0.03
R9585:Igsf9b UTSW 9 27,233,532 (GRCm39) missense probably damaging 1.00
R9720:Igsf9b UTSW 9 27,220,810 (GRCm39) missense probably damaging 0.99
X0013:Igsf9b UTSW 9 27,243,021 (GRCm39) missense possibly damaging 0.89
X0025:Igsf9b UTSW 9 27,220,757 (GRCm39) missense probably damaging 1.00
X0028:Igsf9b UTSW 9 27,245,668 (GRCm39) missense probably damaging 1.00
Z1176:Igsf9b UTSW 9 27,228,649 (GRCm39) critical splice acceptor site probably null
Z1177:Igsf9b UTSW 9 27,245,588 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCAGTGTGGAAGCCAGG -3'
(R):5'- CAATCCTACTGGCAGCTCTGTC -3'

Sequencing Primer
(F):5'- GCCCTAGCCTTGTCTGATGG -3'
(R):5'- AATACAGTCAGTGGCCTGTC -3'
Posted On 2019-06-26