Mutagenetix > Incidental Mutation

Incidental Mutation 'R7212:Igsf9b'

561152

Institutional Source

Beutler Lab

Gene Symbol

Igsf9b

Ensembl Gene

ENSMUSG00000034275

Gene Name

immunoglobulin superfamily, member 9B

Synonyms

LOC235086

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.489) question?

Stock #

R7212 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27299204-27357546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 27331696 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 726 (P726L)

Ref Sequence

ENSEMBL: ENSMUSP00000149356 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]

AlphaFold

E9PZ19

Predicted Effect

probably benign
Transcript: ENSMUST00000115247

SMART Domains

Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000133213
AA Change: P722L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: P722L

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART
transmembrane domain	727	749	N/A	INTRINSIC
low complexity region	750	760	N/A	INTRINSIC
low complexity region	835	843	N/A	INTRINSIC
low complexity region	971	982	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1148	1161	N/A	INTRINSIC
low complexity region	1172	1190	N/A	INTRINSIC
low complexity region	1246	1273	N/A	INTRINSIC
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1313	1326	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000214357
AA Change: P726L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (70/70)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	C	T	6: 83,161,672	A193V	probably benign	Het
4932438A13Rik	C	A	3: 37,048,009	N1363K		Het
Aatf	C	T	11: 84,449,180	R435Q	probably damaging	Het
Abca13	A	G	11: 9,298,854	H2867R	probably benign	Het
Abcd2	C	T	15: 91,159,123	A621T	possibly damaging	Het
Actl11	T	A	9: 107,928,657	S60T	probably damaging	Het
Adam28	T	A	14: 68,637,397	N277I	probably damaging	Het
Adamts13	T	A	2: 27,006,314	C1240S	probably damaging	Het
Arhgap27	C	T	11: 103,360,755	R49Q	probably damaging	Het
Arhgap8	T	G	15: 84,745,792	L108R	probably null	Het
Armc10	T	C	5: 21,660,583	S209P	probably damaging	Het
Atp6v0a1	T	C	11: 101,043,957	F617L	probably benign	Het
Bap1	T	A	14: 31,251,623	N2K	probably damaging	Het
Cass4	T	A	2: 172,427,186	L396*	probably null	Het
Ccdc40	A	G	11: 119,264,444	Q1170R	probably damaging	Het
Cdhr5	C	T	7: 141,272,659	R348H	probably damaging	Het
Cenpj	A	G	14: 56,552,652	S647P	probably benign	Het
Chordc1	T	A	9: 18,295,351		probably null	Het
Chordc1	T	C	9: 18,301,012	S41P	probably damaging	Het
Ckm	T	C	7: 19,415,053		probably null	Het
Clca1	A	C	3: 145,005,966	I756S	probably damaging	Het
Clcn1	T	C	6: 42,291,389	V165A	possibly damaging	Het
Clec4a4	T	A	6: 122,991,745		probably null	Het
Cog7	T	C	7: 121,977,314	K130E	probably damaging	Het
Coq7	A	G	7: 118,510,048	I259T	unknown	Het
Cp	T	C	3: 19,974,966	S536P	probably damaging	Het
Cyp2d10	T	A	15: 82,404,246		probably null	Het
Dcst2	A	G	3: 89,366,300	I162V	probably benign	Het
Dennd4c	A	G	4: 86,802,991	E630G	probably damaging	Het
Dpt	A	T	1: 164,796,915	I62F	probably benign	Het
Ednrb	T	A	14: 103,843,008	I157F	probably damaging	Het
Ext1	A	T	15: 53,345,162	W68R	probably benign	Het
Fgf4	A	G	7: 144,862,786	K152E	probably benign	Het
G530012D18Rik	A	T	1: 85,577,143	T90S	unknown	Het
Galnt17	T	C	5: 130,964,111	T322A	possibly damaging	Het
Gcm1	A	T	9: 78,059,643	D48V	possibly damaging	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Gm49358	G	T	10: 86,825,207	R353L	probably damaging	Het
Golga4	A	G	9: 118,536,840	E320G	possibly damaging	Het
Herc3	T	C	6: 58,918,773	I1002T	probably damaging	Het
Hip1r	T	A	5: 123,973,782	V7E	possibly damaging	Het
Hipk1	G	A	3: 103,777,610	Q230*	probably null	Het
Itgb6	T	C	2: 60,634,654	I345V	probably damaging	Het
Lhx4	G	T	1: 155,724,953	Q29K	probably benign	Het
Manba	A	G	3: 135,567,635	T777A	probably benign	Het
Mcm3ap	A	G	10: 76,501,311	D1360G	probably benign	Het
Meltf	T	A	16: 31,890,814		probably null	Het
Mmp14	T	G	14: 54,435,879	D81E	probably damaging	Het
Naalad2	T	C	9: 18,364,041		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Olfr1354	A	T	10: 78,917,505	I222L	possibly damaging	Het
Olfr881	T	A	9: 37,992,957	M150K	possibly damaging	Het
Pacs2	A	G	12: 113,061,692	D488G	possibly damaging	Het
Psg23	A	G	7: 18,607,139	S397P	probably benign	Het
Rfpl4	C	A	7: 5,110,660	R174L	probably damaging	Het
Runx3	T	A	4: 135,152,779	I3N	probably damaging	Het
Scn5a	A	T	9: 119,543,385	N214K	possibly damaging	Het
Slc27a1	T	C	8: 71,584,448	I412T	probably damaging	Het
Sptbn4	T	G	7: 27,416,785	T530P	probably benign	Het
Tex15	A	T	8: 33,570,826	R95*	probably null	Het
Tex15	T	C	8: 33,572,995	S818P	probably damaging	Het
Tmod1	A	T	4: 46,093,951	K221*	probably null	Het
Tpm3	G	A	3: 90,091,054	D272N	probably benign	Het
Trpm6	T	C	19: 18,853,791	V1340A	probably benign	Het
Ugt2b5	A	T	5: 87,125,272	C512S	probably benign	Het
Vmn2r82	A	T	10: 79,379,434	E417V	probably benign	Het
Wfdc11	T	C	2: 164,664,446	N60S	probably benign	Het
Zfp217	A	T	2: 170,114,152	S975R	probably benign	Het
Zfr	C	T	15: 12,146,223	Q287*	probably null	Het

Other mutations in Igsf9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Igsf9b	APN	9	27319655	missense	probably damaging	1.00
IGL01013:Igsf9b	APN	9	27334304	missense	probably damaging	1.00
IGL01960:Igsf9b	APN	9	27328606	missense	possibly damaging	0.93
IGL02398:Igsf9b	APN	9	27333130	missense	possibly damaging	0.54
IGL03007:Igsf9b	APN	9	27333082	missense	probably damaging	0.98
G1Funyon:Igsf9b	UTSW	9	27334739	utr 3 prime	probably benign
IGL03014:Igsf9b	UTSW	9	27322636	missense	probably benign	0.00
R0127:Igsf9b	UTSW	9	27334385	missense	possibly damaging	0.65
R0376:Igsf9b	UTSW	9	27334582	missense	probably benign	0.01
R0520:Igsf9b	UTSW	9	27323250	missense	probably benign	0.00
R0534:Igsf9b	UTSW	9	27333062	splice site	probably null
R0613:Igsf9b	UTSW	9	27326920	missense	probably damaging	1.00
R0718:Igsf9b	UTSW	9	27323361	critical splice donor site	probably null
R0828:Igsf9b	UTSW	9	27319605	nonsense	probably null
R0879:Igsf9b	UTSW	9	27333742	missense	probably damaging	1.00
R0882:Igsf9b	UTSW	9	27319316	missense	probably damaging	0.98
R0987:Igsf9b	UTSW	9	27332553	splice site	probably null
R1162:Igsf9b	UTSW	9	27326889	missense	probably benign
R1758:Igsf9b	UTSW	9	27334252	missense	possibly damaging	0.50
R1760:Igsf9b	UTSW	9	27317827	missense	possibly damaging	0.82
R1819:Igsf9b	UTSW	9	27311593	missense	probably damaging	0.98
R1823:Igsf9b	UTSW	9	27331732	missense	probably damaging	0.96
R1982:Igsf9b	UTSW	9	27322239	missense	possibly damaging	0.82
R2150:Igsf9b	UTSW	9	27334337	missense	probably damaging	1.00
R2228:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2229:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2250:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R3415:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3416:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3417:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3427:Igsf9b	UTSW	9	27334577	missense	probably damaging	0.99
R4356:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4357:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4358:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4359:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4379:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4416:Igsf9b	UTSW	9	27322917	missense	probably damaging	1.00
R4445:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4446:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4787:Igsf9b	UTSW	9	27317456	missense	probably benign	0.26
R4887:Igsf9b	UTSW	9	27322650	missense	probably benign	0.45
R5085:Igsf9b	UTSW	9	27317437	missense	probably benign	0.03
R5360:Igsf9b	UTSW	9	27311672	missense	probably damaging	0.98
R5417:Igsf9b	UTSW	9	27334276	small insertion	probably benign
R5686:Igsf9b	UTSW	9	27324179	missense	probably damaging	0.99
R5738:Igsf9b	UTSW	9	27328530	missense	probably damaging	0.98
R5869:Igsf9b	UTSW	9	27323235	missense	probably benign	0.44
R6304:Igsf9b	UTSW	9	27342575	missense	probably benign	0.19
R6359:Igsf9b	UTSW	9	27309599	missense	probably benign	0.25
R6367:Igsf9b	UTSW	9	27309525	nonsense	probably null
R6556:Igsf9b	UTSW	9	27329555	missense	probably damaging	1.00
R7058:Igsf9b	UTSW	9	27322854	missense	probably damaging	0.99
R7165:Igsf9b	UTSW	9	27334240	missense	probably benign
R7180:Igsf9b	UTSW	9	27322668	missense	possibly damaging	0.95
R7461:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R7605:Igsf9b	UTSW	9	27323312	missense	probably damaging	0.98
R7609:Igsf9b	UTSW	9	27345890	missense	probably benign
R7613:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R8072:Igsf9b	UTSW	9	27317364	missense	possibly damaging	0.94
R8163:Igsf9b	UTSW	9	27322611	splice site	probably null
R8301:Igsf9b	UTSW	9	27334739	utr 3 prime	probably benign
R8546:Igsf9b	UTSW	9	27333130	missense	possibly damaging	0.54
R8553:Igsf9b	UTSW	9	27333443	missense	probably damaging	0.96
R9438:Igsf9b	UTSW	9	27332543	missense	probably benign	0.03
R9585:Igsf9b	UTSW	9	27322236	missense	probably damaging	1.00
X0013:Igsf9b	UTSW	9	27331725	missense	possibly damaging	0.89
X0025:Igsf9b	UTSW	9	27309461	missense	probably damaging	1.00
X0028:Igsf9b	UTSW	9	27334372	missense	probably damaging	1.00
Z1176:Igsf9b	UTSW	9	27317353	critical splice acceptor site	probably null
Z1177:Igsf9b	UTSW	9	27334292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTCAGTGTGGAAGCCAGG -3'
(R):5'- CAATCCTACTGGCAGCTCTGTC -3'

Sequencing Primer
(F):5'- GCCCTAGCCTTGTCTGATGG -3'
(R):5'- AATACAGTCAGTGGCCTGTC -3'

Posted On

2019-06-26